WormBase Tree Display for Variation: WBVar00092597
expand all nodes | collapse all nodes | view schema
WBVar00092597 | Evidence | Person_evidence | WBPerson2969 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok1381 | ||||||
HGVSg | CHROMOSOME_I:g.6989021_6991337del | |||||||
Sequence_details | SMap | S_parent | Sequence | C30F12 | ||||
Flanking_sequences | aataactttttactttacgtttttgaaaac | attggtaattaaaatcaataatttcgattc | ||||||
Mapping_target | C30F12 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK1381_external | |||||||
OK1381_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031983 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
WBPerson2969 | ||||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00016265 | ||||||
Transcript | C30F12.6.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
Intron_number | 2-8/9 | |||||||
Exon_number | 1-8/10 | |||||||
Description | Phenotype_not_observed | WBPhenotype:0001012 | Paper_evidence | WBPaper00032196 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were as susceptible to infection by P. aeruginosa as N2 animals. | Paper_evidence | WBPaper00032196 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Strain | WBStrain00031983 | Paper_evidence | WBPaper00032196 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00032196 | |||||||
Remark | Allele sequenced by Neline Kriek | Curator_confirmed | WBPerson2970 | |||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |