WormBase Tree Display for Variation: WBVar00092602
expand all nodes | collapse all nodes | view schema
WBVar00092602 | Evidence | Person_evidence | WBPerson2969 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok1387 | ||||||
Other_name | C48C5.1.1:c.508-235_857-277del | |||||||
HGVSg | CHROMOSOME_X:g.8982345_8983585del | |||||||
Sequence_details | SMap | S_parent | Sequence | C48C5 | ||||
Flanking_sequences | tttaagaaaacaccacttgaaaaacgcaga | agtctagtggtctagtgaaccagtttgcaa | ||||||
Mapping_target | C48C5 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK1387_external | |||||||
OK1387_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031987 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
WBPerson2969 | ||||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00016747 | ||||||
Transcript | C48C5.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C48C5.1.1:c.508-235_857-277del | |||||||
Intron_number | 4-8/11 | |||||||
Exon_number | 5-8/12 | |||||||
Description | Phenotype | WBPhenotype:0001014 | Paper_evidence | WBPaper00032196 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were less susceptible to infection by P. aeruginosa than N2 animals due to significant differences (p<0.0001) in survival compared to wild type in two independent experiments using PRISM to apply a logrank test. | Paper_evidence | WBPaper00032196 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Strain | WBStrain00031987 | Paper_evidence | WBPaper00032196 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002598 | Paper_evidence | WBPaper00059641 | ||||||
Curator_confirmed | WBPerson10038 | |||||||
Remark | Quote from paper: "Similar to classical aversive conditioning, we trained worms by pairing a conditioned salt stimulus with the absence of food during a 15-min training period (Fig. 1c). We then tested salt chemotaxis behavior... Consistent with our hypothesis, nmur-1 mutants were defective in learning and still attracted to salt after NaCl-conditioning (Fig.1d)." | Paper_evidence | WBPaper00059641 | |||||
Curator_confirmed | WBPerson10038 | |||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00059641 | ||||
Curator_confirmed | WBPerson10038 | |||||||
Reference | WBPaper00032196 | |||||||
WBPaper00059641 | ||||||||
Remark | Allele sequenced by Neline Kriek | Curator_confirmed | WBPerson2970 | |||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |