WormBase Tree Display for Variation: WBVar00092724
expand all nodes | collapse all nodes | view schema
WBVar00092724 | Name | Public_name | ok1513 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | Y42H9AR.3a.1:c.109_1503-60del | ||||||||
Y42H9AR.3b.1:c.109_1503-54del | |||||||||
HGVSg | CHROMOSOME_IV:g.8104730_8107114del | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y42H9AR | |||||
Flanking_sequences | gcgaattcacttcaagaaaggcgtagctat | gagtcgttcgtattctccaaagtcttccat | |||||||
Mapping_target | Y42H9AR | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok1513_external | ||||||||
ok1513_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00036301 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00021538 | |||||||
Transcript | Y42H9AR.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y42H9AR.3a.1:c.109_1503-60del | ||||||||
cDNA_position | 113-? | ||||||||
CDS_position | 109-? | ||||||||
Protein_position | 37-? | ||||||||
Intron_number | 3-7/8 | ||||||||
Exon_number | 3-7/9 | ||||||||
Y42H9AR.3b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y42H9AR.3b.1:c.109_1503-54del | ||||||||
cDNA_position | 111-? | ||||||||
CDS_position | 109-? | ||||||||
Protein_position | 37-? | ||||||||
Intron_number | 3-7/8 | ||||||||
Exon_number | 3-7/9 | ||||||||
Isolation | Mutagen | UV/TMP | |||||||
Genetics | Mapping_data | In_multi_point | 5613 | ||||||
Description | Phenotype | WBPhenotype:0001425 | Paper_evidence | WBPaper00029049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were indistinguishable from vsp-45 mutants for this phenotype. | Paper_evidence | WBPaper00029049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00029049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15, 25 | Paper_evidence | WBPaper00029049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | vitellogenin::EGFP (YP170/EGFP) | Paper_evidence | WBPaper00029049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00029049 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were indistinguishable from vsp-45 mutants for this phenotype. | Paper_evidence | WBPaper00029049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005751 | PATO:0000460 | Paper_evidence | WBPaper00029049 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00029049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15, 25 | Paper_evidence | WBPaper00029049 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | Pmyo-3::ssGFP | Paper_evidence | WBPaper00029049 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000256 | Paper_evidence | WBPaper00048972 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Third, the mammalian homologue of PMK-3, p38 MAPK, was shown to accelerate Rab5-mediated endocytosis by phosphorylating and activating GDI [34, 41, 42]. In addition, p38 MAPK regulates endocytosis by phosphorylating the Rab5 effector proteins EEA1 (EEA-1 in C_elegans) and Rabenosyn-5 (RABS-5) involved in tethering/docking and fusion of endosomes [35]. Neither eea-1(tm9033) [sic] or rabs-5(ok1513) suppressed the dye-filling defect of gpa-3QL (gjEx862) (Fig 5B)." | Paper_evidence | WBPaper00048972 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | gpa-3QL(gjEx862) | Paper_evidence | WBPaper00048972 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0010004 | Paper_evidence | WBPaper00031805 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Disruption of the FYVE-domain-containing proteins did not cause obvious defects in corpse removal in the germ line | Paper_evidence | WBPaper00031805 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00031805 | ||||||||
WBPaper00029049 | |||||||||
WBPaper00048972 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |