WormBase Tree Display for Variation: WBVar00092789
expand all nodes | collapse all nodes | view schema
WBVar00092789 | Evidence | Person_evidence | WBPerson1168 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok1580 | ||||||
Other_name | ZC328.4.1:c.327_1089+13del | |||||||
HGVSg | CHROMOSOME_I:g.6407947_6408938del | |||||||
Sequence_details | SMap | S_parent | Sequence | ZC328 | ||||
Flanking_sequences | aactgaaaaaaacaataaaatatattttag | taaaataatttaaaaaaaacattttgaagg | ||||||
Mapping_target | ZC328 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok1580_external | |||||||
ok1580_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00032089 | |||||||
WBStrain00034701 | ||||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
WBPerson1168 | ||||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00004721 | ||||||
Transcript | ZC328.4.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | ZC328.4.1:c.327_1089+13del | |||||||
cDNA_position | 335-? | |||||||
CDS_position | 327-? | |||||||
Protein_position | 109-? | |||||||
Intron_number | 4-8/9 | |||||||
Exon_number | 4-8/10 | |||||||
Genetics | Mapping_data | In_multi_point | 5246 | |||||
Description | Phenotype | WBPhenotype:0001989 | Paper_evidence | WBPaper00034694 | ||||
Curator_confirmed | WBPerson2857 | |||||||
Remark | embryos in uterus of animals exposed to 1000 ppm oxygen die | Paper_evidence | WBPaper00034694 | |||||
Curator_confirmed | WBPerson2857 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00032281 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals produced viable progeny at levels similar to N2 control animals. | Paper_evidence | WBPaper00032281 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00032281 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Hermaphrodites were fed HT115(DE3) bacteria carrying the pUC19 control plasmid. Total numbers of eggs laid and viable progenies of three hermaphrodites were counted, and the percentages of viable progeny were calculated. | Paper_evidence | WBPaper00032281 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00032281 | |||||||
WBPaper00034694 | ||||||||
Remark | Allele sequenced by Risa Kitagawa | |||||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |