WormBase Tree Display for Variation: WBVar00092798
expand all nodes | collapse all nodes | view schema
WBVar00092798 | Name | Public_name | ok1589 | ||||
---|---|---|---|---|---|---|---|
Other_name | C33F10.5d.1:c.812-1324_938+103del | ||||||
HGVSg | CHROMOSOME_II:g.4801548_4803101del | ||||||
Sequence_details | SMap | S_parent | Sequence | C33F10 | |||
Flanking_sequences | ttaatcttattaaaatattcattggtttta | gaatggaaggagttggttgcaatttgatta | |||||
Mapping_target | C33F10 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | OK1589_external | ||||||
OK1589_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00036345 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00016354 | |||||
Transcript | C33F10.5d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | C33F10.5d.1:c.812-1324_938+103del | ||||||
Intron_number | 4-5/13 | ||||||
Exon_number | 5/14 | ||||||
Isolation | Mutagen | EMS | |||||
Description | Phenotype | WBPhenotype:0000632 | Paper_evidence | WBPaper00053043 | |||
Curator_confirmed | WBPerson35337 | ||||||
Phenotype_not_observed | WBPhenotype:0002520 | Paper_evidence | WBPaper00060680 | ||||
Curator_confirmed | WBPerson557 | ||||||
Remark | Authors did not observe any abnormalities in gap junction formation between EA/EP cells in the embryo in rig-6(ok1589) mutants. | Paper_evidence | WBPaper00060680 | ||||
Curator_confirmed | WBPerson557 | ||||||
Reference | WBPaper00053043 | ||||||
WBPaper00060680 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |