WormBase Tree Display for Variation: WBVar00092840
expand all nodes | collapse all nodes | view schema
WBVar00092840 | Name | Public_name | ok1632 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F55B12.3b.1:c.55_531-19delinsGTATTATCTAGTATT | |||||||
F55B12.3a.1:c.55_537-19delinsGTATTATCTAGTATT | ||||||||
HGVSg | CHROMOSOME_V:g.13819419_13820319delinsGTATTATCTAGTATT | |||||||
Sequence_details | SMap | S_parent | Sequence | F55B12 | ||||
Flanking_sequences | atggatgatggatcgatgacaccggaggac | ttagtattatcttttcagagaccgagttac | ||||||
Mapping_target | F55B12 | |||||||
Type_of_mutation | Insertion | GTATTATCTAGTATT | Paper_evidence | WBPaper00032114 | ||||
Deletion | ||||||||
PCR_product | OK1632_external | |||||||
OK1632_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00032130 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00004767 | ||||||
Transcript | F55B12.3b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F55B12.3b.1:c.55_531-19delinsGTATTATCTAGTATT | |||||||
cDNA_position | 59-? | |||||||
CDS_position | 55-? | |||||||
Protein_position | 19-? | |||||||
Intron_number | 2-6/12 | |||||||
Exon_number | 2-6/13 | |||||||
F55B12.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F55B12.3a.1:c.55_537-19delinsGTATTATCTAGTATT | |||||||
cDNA_position | 59-? | |||||||
CDS_position | 55-? | |||||||
Protein_position | 19-? | |||||||
Intron_number | 2-6/12 | |||||||
Exon_number | 2-6/13 | |||||||
Interactor | WBInteraction000519136 | |||||||
Isolation | Mutagen | EMS | ||||||
Description | Phenotype | WBPhenotype:0001645 | Paper_evidence | WBPaper00053760 | ||||
Curator_confirmed | WBPerson150 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00053760 | |||||
Curator_confirmed | WBPerson150 | |||||||
Recessive | Paper_evidence | WBPaper00053760 | ||||||
Curator_confirmed | WBPerson150 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00053760 | |||||
Curator_confirmed | WBPerson150 | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00053760 | |||||
Curator_confirmed | WBPerson150 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00053760 | ||||
Curator_confirmed | WBPerson150 | |||||||
Reference | WBPaper00053760 | |||||||
Remark | the precise mutation was updated based on this paper. | Paper_evidence | WBPaper00032114 | |||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |