WormBase Tree Display for Variation: WBVar00092846
expand all nodes | collapse all nodes | view schema
WBVar00092846 | Name | Public_name | ok1638 | ||
---|---|---|---|---|---|
Other_name | F13G3.5a.1:c.391_662delinsG | ||||
CE48079:p.Pro131ValfsTer95 | |||||
F13G3.5a.2:c.391_662delinsG | |||||
CE47972:p.Pro131ValfsTer95 | |||||
F13G3.5b.1:c.391_653delinsG | |||||
CE47972:p.Pro131ValfsTer93 | |||||
HGVSg | CHROMOSOME_I:g.7301361_7302156delinsC | ||||
Sequence_details | SMap | S_parent | Sequence | F13G3 | |
Flanking_sequences | CAATGATAGAAGGAGCAGCAACATCCCAAGCGTGAATCCCGTATTCAACA | ATTGTATACGATTCCAGCACGAATTTGTTTTTTGATTGCAAGTCCAACGC | |||
Mapping_target | F13G3 | ||||
Type_of_mutation | Insertion | C | |||
Deletion | |||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00032133 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
KO_consortium_allele | |||||
Status | Live | Curator_confirmed | WBPerson4025 | ||
Affects | Gene | WBGene00008765 | |||
Transcript | F13G3.5a.1 (11) | ||||
F13G3.5b.1 (11) | |||||
F13G3.5a.2 (11) | |||||
Isolation | Mutagen | EMS | |||
Remark | This was suppressed because it overlapped with a corrected genome sequence error feature | Feature_evidence | WBsf898425 | ||
This was un-suppressed after examination showed it is not changed by the corrected genome sequence error | Curator_confirmed | WBPerson4025 | |||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |