WormBase Tree Display for Variation: WBVar00092848
expand all nodes | collapse all nodes | view schema
WBVar00092848 | Name | Public_name | ok1640 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F49E12.1.1:c.419_1533-162del | |||||||
HGVSg | CHROMOSOME_II:g.8401649_8404024del | |||||||
Sequence_details | SMap | S_parent | Sequence | F49E12 | ||||
Flanking_sequences | tctcttgataagtctgtagatggtaaacgt | ggaagcactgattgatggaacaatctggag | ||||||
Mapping_target | F49E12 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK1640_external | |||||||
OK1640_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00032135 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects (3) | ||||||||
Isolation | Mutagen | EMS | ||||||
Description | Phenotype | WBPhenotype:0000583 | Paper_evidence | WBPaper00044963 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | skpo-1 mutant young adults ranged from very dumpy (16.5%), to slightly dumpy (32.9%), to wild type (50.6%) in appearance. | Paper_evidence | WBPaper00044963 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00044963 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001012 | Paper_evidence | WBPaper00044963 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | E. faecalis infected mutant animals released significantly greater amounts of H2O2, to wild-type animals. No difference in H2O2 release was observed on E. coli. | Paper_evidence | WBPaper00044963 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | with or without cdc-25.1 RNAi treatment | Paper_evidence | WBPaper00044963 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00044963 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were very susceptible to E. faecalis compared to wild-type N2 animals. In addition animals exhibited a significant "bagging" phenotype - hatching of embryos inside the hermaphrodite that had failed to be expelled, when the skpo-1 mutant animals were exposed to E. faecalis. Interestingly, we observed no significant difference in survival between cdc-25.1 RNAi skpo-1 mutants and cdc-25.1 RNAi wild-type animals when exposed to P. aeruginosa. Susceptibility was independent of dumpy appearance. | Paper_evidence | WBPaper00044963 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | with or without cdc-25.1 RNAi treatment | Paper_evidence | WBPaper00044963 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00044963 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Regardless of whether skpo-1 mutant worms were sterile, from cdc-25.1 RNAi treatment or fecund (no treatment), they displayed a slight reduction in lifespan, relative to wild type, when exposed to live E. coli, OP50. Shortened lifespan was also observed for treated worms on heat-killed OP50. | Paper_evidence | WBPaper00044963 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0002164 | Paper_evidence | WBPaper00044963 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | By qRT-PCR, expression of clec-60 was significantly higher in the skpo-1 mutant and there was a trend toward increased expression of clec-42, which was not statistically significant. No significant difference in the expression of clec-35 and -71 was observed between the wild type and skpo-1 mutants exposed to E. faecalis. | Paper_evidence | WBPaper00044963 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000025 | Paper_evidence | WBPaper00044963 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | No blistering of the cuticle was ever observed. | Paper_evidence | WBPaper00044963 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00044963 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001819 | Paper_evidence | WBPaper00044963 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | No significant difference in CFUs (colony forming units) perworm between the wild-type and skpo-1 mutant animals was observed after either 12 or 36 hours of exposure to E. faecalis. | Paper_evidence | WBPaper00044963 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00044963 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |