WormBase Tree Display for Variation: WBVar00092899

WBVar00092899 Evidence: Paper_evidence: WBPaper00032243
  Name: Public_name: ok1693
  Sequence_details: SMap: S_parent: Sequence: C23H3
    Flanking_sequences: ccgatacgccggattttttcaatttcggca cgatgggacagcaccccgtgttacctatat
    Mapping_target: C23H3
    Type_of_mutation: Deletion
    PCR_product: ok1693_external
      ok1693_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00032163
    Laboratory: RB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00016020
  Isolation: Mutagen: EMS
  Description: Phenotype_not_observed: WBPhenotype:0002541 Paper_evidence: WBPaper00032243
        Curator_confirmed: WBPerson712
        Remark: Radiation-induced germ cell apoptosis was not inhibited. Paper_evidence: WBPaper00032243
            Curator_confirmed: WBPerson712
        EQ_annotations: Anatomy_term: WBbt:0005784 PATO:0000460 Paper_evidence: WBPaper00032243
                Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: At least 20 animals were scored for germ cell apoptosis at 36 hours post-120 Gy and compared to WT-irradiated controls. Paper_evidence: WBPaper00032243
              Curator_confirmed: WBPerson712
  Reference: WBPaper00032243
  Remark: Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele