WormBase Tree Display for Variation: WBVar00092911
expand all nodes | collapse all nodes | view schema
| WBVar00092911 | Name | Public_name | ok1706 | ||||
|---|---|---|---|---|---|---|---|
| Other_name | ZK856.1.1:c.1389_1855-22del | ||||||
| HGVSg | CHROMOSOME_V:g.10181657_10182383del | ||||||
| Sequence_details | SMap | S_parent | Sequence | ZK856 | |||
| Flanking_sequences | agagatgatggtgacaaaacttcgagaatg | ataatgcatttcttatttcagtcactggtt | |||||
| Mapping_target | ZK856 | ||||||
| Type_of_mutation | Deletion | ||||||
| PCR_product | ok1706_external | ||||||
| ok1706_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00032168 | ||||||
| Laboratory | RB | ||||||
| Person | WBPerson46 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00000840 | |||||
| Transcript | ZK856.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | ZK856.1.1:c.1389_1855-22del | ||||||
| cDNA_position | 1419-? | ||||||
| CDS_position | 1389-? | ||||||
| Protein_position | 463-? | ||||||
| Intron_number | 10-14/16 | ||||||
| Exon_number | 10-14/17 | ||||||
| Interactor | WBInteraction000009242 | ||||||
| WBInteraction000009249 | |||||||
| Isolation | Mutagen | EMS | |||||
| Genetics | Mapping_data | In_multi_point | 5581 | ||||
| Description | Phenotype | WBPhenotype:0000210 | Person_evidence | WBPerson2838 | |||
| Curator_confirmed | WBPerson48 | ||||||
| Remark | Defect of EMC (enteric muscle contraction) causes constipated phenotype. | Person_evidence | WBPerson2838 | ||||
| Curator_confirmed | WBPerson48 | ||||||
| WBPhenotype:0000643 | Person_evidence | WBPerson2838 | |||||
| Curator_confirmed | WBPerson48 | ||||||
| WBPhenotype:0000651 | Person_evidence | WBPerson2838 | |||||
| Curator_confirmed | WBPerson48 | ||||||
| Phenotype_not_observed | WBPhenotype:0000050 | Person_evidence | WBPerson2838 | ||||
| Curator_confirmed | WBPerson48 | ||||||
| WBPhenotype:0000688 | Person_evidence | WBPerson2838 | |||||
| Curator_confirmed | WBPerson48 | ||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
| Method | KO_consortium_allele |
