WormBase Tree Display for Variation: WBVar00092960
expand all nodes | collapse all nodes | view schema
| WBVar00092960 | Evidence | Paper_evidence | WBPaper00033444 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | ok1758 | |||||
| Other_name | F55F3.3b.1:c.97+12_305delinsT | ||||||
| F55F3.3a.1:c.139+12_347delinsT | |||||||
| HGVSg | CHROMOSOME_X:g.13767109_13768474delinsA | ||||||
| Sequence_details | SMap | S_parent | Sequence | F55F3 | |||
| Flanking_sequences | tgtttcacatatggctcccaggatttggag | acaaaacttacaccaagaggttcctgtcct | |||||
| Mapping_target | F55F3 | ||||||
| Type_of_mutation | Insertion | A | |||||
| Deletion | |||||||
| PCR_product | OK1758_external | ||||||
| OK1758_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00032190 | ||||||
| Laboratory | RB | ||||||
| Person | WBPerson46 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00010117 | |||||
| Transcript | F55F3.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F55F3.3a.1:c.139+12_347delinsT | ||||||
| cDNA_position | ?-393 | ||||||
| CDS_position | ?-347 | ||||||
| Protein_position | ?-116 | ||||||
| Intron_number | 3-4/8 | ||||||
| Exon_number | 4-5/9 | ||||||
| F55F3.3b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | F55F3.3b.1:c.97+12_305delinsT | ||||||
| cDNA_position | ?-305 | ||||||
| CDS_position | ?-305 | ||||||
| Protein_position | ?-102 | ||||||
| Intron_number | 1-2/6 | ||||||
| Exon_number | 2-3/7 | ||||||
| Isolation | Mutagen | EMS | |||||
| Description | Phenotype | WBPhenotype:0000519 | Paper_evidence | WBPaper00033444 | |||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | Mutant strains tested showed altered fitness compared to wild type when exposed to different bacterial environments such as E. coli, M. luteus, and Pseudomonas sp.and B. megaterium | Paper_evidence | WBPaper00033444 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Variation_effect | Null | Paper_evidence | WBPaper00033444 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Reference | WBPaper00033444 | ||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
| Method | KO_consortium_allele |
