WormBase Tree Display for Variation: WBVar00092997
expand all nodes | collapse all nodes | view schema
WBVar00092997 | Name | Public_name | ok1799 | ||||
---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_I:g.7801621_7802315del | ||||||
Sequence_details | SMap | S_parent | Sequence | D2005 | |||
Flanking_sequences | cggtgaagcaggaaagatcaggtaggggta | aataagaaacattgaggaatttatgaatga | |||||
Mapping_target | D2005 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | OK1799_external | ||||||
OK1799_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00036501 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects (2) | |||||||
Isolation | Mutagen | EMS | |||||
Description | Phenotype (17) | ||||||
Phenotype_not_observed | WBPhenotype:0002432 | Paper_evidence | WBPaper00050011 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Null mutation of this neuropeptide had little or no effect on stress-induced sleep. To determine whether ALA-enriched neuropeptides are necessary for stress-induced sleep, we assayed locomotion, head movement, pharyngeal pumping, avoidance response, and defecation before and 30 min after heat shock. Single-null mutants were indistinguishable from wild-type with respect to pumping, locomotion, and head movement after heat shock. | Paper_evidence | WBPaper00050011 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00043908 | ||||||
WBPaper00050011 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |