WormBase Tree Display for Variation: WBVar00093019
expand all nodes | collapse all nodes | view schema
WBVar00093019 | Name | Public_name | ok1821 | ||||||
---|---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_I:g.5759781_5761550del | ||||||||
Sequence_details | SMap | S_parent | Sequence | T22E7 | |||||
Flanking_sequences | aataattgaagatgtttgtcaagaagtaga | gcctcacactcttcttcagacattccttgc | |||||||
Mapping_target | T22E7 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | OK1821_external | ||||||||
OK1821_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00032218 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00018995 | |||||||
WBGene00045483 | |||||||||
Transcript | F56H1.5.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
cDNA_position | ?-722 | ||||||||
CDS_position | ?-701 | ||||||||
Protein_position | ?-234 | ||||||||
Intron_number | 2-6/19 | ||||||||
Exon_number | 1-7/20 | ||||||||
F56H1.7.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
cDNA_position | 527-? | ||||||||
CDS_position | 459-? | ||||||||
Protein_position | 153-? | ||||||||
Intron_number | 4/5 | ||||||||
Exon_number | 4-6/6 | ||||||||
Interactor | WBInteraction000505076 | ||||||||
WBInteraction000505138 | |||||||||
Isolation | Mutagen | EMS | |||||||
Description | Phenotype | WBPhenotype:0002038 | Paper_evidence | WBPaper00040278 | |||||
Curator_confirmed | WBPerson3755 | ||||||||
WBPhenotype:0002212 | Paper_evidence | WBPaper00040278 | |||||||
Curator_confirmed | WBPerson3755 | ||||||||
Remark | Dyf defect becomes progressively more severe with age. | Paper_evidence | WBPaper00040278 | ||||||
Curator_confirmed | WBPerson3755 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005391 | PATO:0000460 | Paper_evidence | WBPaper00040278 | ||||
Curator_confirmed | WBPerson3755 | ||||||||
Reference | WBPaper00040278 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |