WormBase Tree Display for Variation: WBVar00093027
expand all nodes | collapse all nodes | view schema
WBVar00093027 | Name | Public_name | ok1829 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | F55A3.7:n.445_1276+179delinsTT | ||||||||
HGVSg | CHROMOSOME_I:g.10785807_10787148delinsAA | ||||||||
Sequence_details | SMap | S_parent | Sequence | F55A3 | |||||
Flanking_sequences | tagattatctcgtgttaattcgcgaatata | aactgcgaacagatgagtaaacgcgagagt | |||||||
Mapping_target | F55A3 | ||||||||
Type_of_mutation | Insertion | AA | |||||||
Deletion | |||||||||
PCR_product | OK1829_external | ||||||||
OK1829_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00032220 | ||||||||
WBStrain00048376 | |||||||||
WBStrain00048380 | |||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00018852 | |||||||
Pseudogene | F55A3.7 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,non_coding_transcript_exon_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F55A3.7:n.445_1276+179delinsTT | ||||||||
cDNA_position | 445-? | ||||||||
Intron_number | 2-3/3 | ||||||||
Exon_number | 2-3/4 | ||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype | WBPhenotype:0000414 | Paper_evidence | WBPaper00061371 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Indeed, after broad induction of the ASE neuron specifying TF CHE-1 in L4 animals, ectopic expression of the ASE neuron fate reporter gcy-5p::GFP could be detected in the germline (assessed after 24 h) (Figure 1B). Some reprogrammed germ cells showed axo-dendritic projections (Figure 1B, bottom right), indicating that they acquired neuronal-like features. | Paper_evidence | WBPaper00061371 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | BAT372 F55A3.7(ok1829) I; otIs305 [hsp-16.2p::che-1::3xHA, rol-6(su1006)], ntIs1 [gcy-5p::GFP, lin-15(+)] V OR BAT2192 F55A3.7(ok1829) I; otIs355 [rab-3::NLS::TagRFP]; otIs305 [hsp-16.2p::che-1::3xHA, rol-6(su1006)], ntIs1 [gcy-5p::GFP, lin-15(+)] V. | Paper_evidence | WBPaper00061371 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001276 | Paper_evidence | WBPaper00061371 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Indeed, after broad induction of the ASE neuron specifying TF CHE-1 in L4 animals, ectopic expression of the ASE neuron fate reporter gcy-5p::GFP could be detected in the germline (assessed after 24 h) (Figure 1B). Some reprogrammed germ cells showed axo-dendritic projections (Figure 1B, bottom right), indicating that they acquired neuronal-like features. Additionally, reprogrammed germ cells also express the pan-neuronal marker rab-3p::NLS::tagRFP, corroborating the notion that the sspt-16 depletion background allows conversion of germ cells to neuron like-cells upon induction of CHE-1 overexpression. | Paper_evidence | WBPaper00061371 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | BAT372 F55A3.7(ok1829) I; otIs305 [hsp-16.2p::che-1::3xHA, rol-6(su1006)], ntIs1 [gcy-5p::GFP, lin-15(+)] V OR BAT2192 F55A3.7(ok1829) I; otIs355 [rab-3::NLS::TagRFP]; otIs305 [hsp-16.2p::che-1::3xHA, rol-6(su1006)], ntIs1 [gcy-5p::GFP, lin-15(+)] V. | Paper_evidence | WBPaper00061371 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001510 | Paper_evidence | WBPaper00061371 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Indeed, after broad induction of the ASE neuron specifying TF CHE-1 in L4 animals, ectopic expression of the ASE neuron fate reporter gcy-5p::GFP could be detected in the germline (assessed after 24 h) (Figure 1B). Some reprogrammed germ cells showed axo-dendritic projections (Figure 1B, bottom right), indicating that they acquired neuronal-like features. | Paper_evidence | WBPaper00061371 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | BAT372 F55A3.7(ok1829) I; otIs305 [hsp-16.2p::che-1::3xHA, rol-6(su1006)], ntIs1 [gcy-5p::GFP, lin-15(+)] V OR BAT2192 F55A3.7(ok1829) I; otIs355 [rab-3::NLS::TagRFP]; otIs305 [hsp-16.2p::che-1::3xHA, rol-6(su1006)], ntIs1 [gcy-5p::GFP, lin-15(+)] V. | Paper_evidence | WBPaper00061371 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000717 | Paper_evidence | WBPaper00061371 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mRNA or protein levels analyzed through qPCR and whole worm western blots of FACT members, spt-16, hmg-3 and lin-53 did not differ from WT. | Paper_evidence | WBPaper00061371 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | gcy-5p::GFP | Paper_evidence | WBPaper00061371 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002632 | Paper_evidence | WBPaper00061371 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | We performed a germline-specific Assay for Transposase Accessible Chromatin with high-throughput sequencing (ATAC-seq). However, we found no significant differences in chromatin accessibility of WT vs. sspt-16(ok1829) germlines (Figure 1G). | Paper_evidence | WBPaper00061371 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | GO_term | GO:0034401 | PATO:0000460 | Paper_evidence | WBPaper00061371 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | gcy-5p::GFP | Paper_evidence | WBPaper00061371 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00061371 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |