WormBase Tree Display for Variation: WBVar00093036
expand all nodes | collapse all nodes | view schema
WBVar00093036 | Name | Public_name | ok1838 | ||
---|---|---|---|---|---|
Other_name | F25C8.2a.1:c.4-8_975+490del | ||||
HGVSg | CHROMOSOME_V:g.20900028_20901608del | ||||
Sequence_details | SMap | S_parent | Sequence | F25C8 | |
Flanking_sequences | ccttattgtaatttttgcaaaatccttaaa | tgcaaaagtttgtcagacagtttcttagtg | |||
Mapping_target | F25C8 | ||||
Type_of_mutation | Deletion | ||||
PCR_product | OK1838_external | ||||
OK1838_internal | |||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00032229 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00000139 | |||
Transcript | F25C8.2b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
Intron_number | 1-3/4 | ||||
Exon_number | 1-3/5 | ||||
F25C8.2a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||
VEP_impact | HIGH | ||||
HGVSc | F25C8.2a.1:c.4-8_975+490del | ||||
Intron_number | 2-5/7 | ||||
Exon_number | 3-5/8 | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00065359 | ||||
Remark | Breakpoints should be confirmed; manual analysis was required due to poor sequence quality in the breakpoint region. | ||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |