WormBase Tree Display for Variation: WBVar00093055
expand all nodes | collapse all nodes | view schema
WBVar00093055 | Evidence | Paper_evidence | WBPaper00036195 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ok1858 | |||||||
Other_name | F40F4.5.1:c.242-383_954+156delinsTT | ||||||||
HGVSg | CHROMOSOME_X:g.3253944_3255284delinsTT | ||||||||
Sequence_details | SMap | S_parent | Sequence | F40F4 | |||||
Flanking_sequences | aaaatgcgggaggttagacgcagacttttc | tttttattccgtttcaaaatgtggtctcac | |||||||
Mapping_target | F40F4 | ||||||||
Type_of_mutation | Insertion | TT | |||||||
Deletion | |||||||||
PCR_product | OK1858_external | ||||||||
OK1858_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (6) | |||||||||
Affects (3) | |||||||||
Isolation | Mutagen | EMS | |||||||
Description | Phenotype | WBPhenotype:0000641 | Paper_evidence | WBPaper00036195 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | These animals also exhibited a hyperexploratory phenotype: in exploratory behavior assays, these animals consistently moved throughmore areas of the plate than wild-type controls (data not shown). | Paper_evidence | WBPaper00036195 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000664 | Paper_evidence | WBPaper00036195 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | tba-9 hermaphrodites and males displayed increases in body bend frequency and flex, a measurement of bending angle(data not shown). | Paper_evidence | WBPaper00036195 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000961 | Paper_evidence | WBPaper00036195 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | In wild-type males, TRP-4::GFP accumulated in cilia; in mutants, ciliary localization was still present but TRP-4 existed in notably larger punctae. | Paper_evidence | WBPaper00036195 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006972 | PATO:0000460 | Paper_evidence | WBPaper00036195 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001221 | Paper_evidence | WBPaper00036195 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | A significant reduction was observed in the response of mutants to nose touch when compared to wild-type controls. | Paper_evidence | WBPaper00036195 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00036195 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Uptake of the dye DiD by amphid and phasmid neurons was not grossly compromised; however, the ASI amphid neuron sometimes failed to fill with dye. Similar results were obtained when the IL2 neurons were labeled with DiO in the presence of calcium acetate. | Paper_evidence | WBPaper00036195 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0004006 | Paper_evidence | WBPaper00036195 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutant males responded with a frequency of 60%. | Paper_evidence | WBPaper00036195 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0004017 | Paper_evidence | WBPaper00036195 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | tba-9 hermaphrodites and males displayed increases in body bend frequency and flex, a measurement of bending angle(data not shown). | Paper_evidence | WBPaper00036195 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000649 | Paper_evidence | WBPaper00036195 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males that responded to contact were able to locate the hermaphrodite vulva with wild-type efficiency and mate successfully. | Paper_evidence | WBPaper00036195 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00036195 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | We detected no apparent mislocalization of TBB-4::YFP in tba-9 mutants (data not shown). However, In wild-type males, TRP-4::GFP accumulated in cilia; in mutants, ciliary localization was still present. | Paper_evidence | WBPaper00036195 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001462 | Paper_evidence | WBPaper00036195 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No differences were observed in the response of mutants using a four-quadrant salt chemotaxis assay compared to wild-type controls. | Paper_evidence | WBPaper00036195 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001470 | Paper_evidence | WBPaper00036195 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants all responded robustly to the AWA-sensed odorant diacetyl (data not shown). | Paper_evidence | WBPaper00036195 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00036195 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |