WormBase Tree Display for Variation: WBVar00093080
expand all nodes | collapse all nodes | view schema
WBVar00093080 | Evidence | Paper_evidence | WBPaper00033073 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ok1884 | |||||
Other_name | R186.5c.1:c.45-299_439-259del | ||||||
R186.5a.2:c.-10-299_385-259del | |||||||
R186.5b.1:c.54-299_448-259del | |||||||
R186.5a.1:c.-10-299_385-259del | |||||||
HGVSg | CHROMOSOME_V:g.12975529_12976640del | ||||||
Sequence_details | SMap | S_parent | Sequence | R186 | |||
Flanking_sequences | aaactttaaaatgaagcttcaaaatttcaa | tcactttggagtcgactacggtaggaggag | |||||
Mapping_target | R186 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | ok1884_external | ||||||
ok1884_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00032252 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00201025 | |||||
WBGene00004793 | |||||||
Transcript | R186.13 | VEP_consequence | transcript_ablation | ||||
VEP_impact | HIGH | ||||||
Exon_number | 1/1 | ||||||
R186.5a.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
Intron_number | 2-5/10 | ||||||
Exon_number | 1-5/11 | ||||||
R186.5c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | R186.5c.1:c.45-299_439-259del | ||||||
Intron_number | 1-5/9 | ||||||
Exon_number | 2-5/10 | ||||||
R186.5b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | R186.5b.1:c.54-299_448-259del | ||||||
Intron_number | 1-5/9 | ||||||
Exon_number | 2-5/10 | ||||||
R186.5a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | R186.5a.2:c.-10-299_385-259del | ||||||
Intron_number | 1-6/11 | ||||||
Exon_number | 2-6/12 | ||||||
R186.5a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | R186.5a.1:c.-10-299_385-259del | ||||||
Intron_number | 1-6/11 | ||||||
Exon_number | 2-6/12 | ||||||
Isolation | Mutagen | UV/TMP | |||||
Description | Phenotype | WBPhenotype:0000316 | Paper_evidence | WBPaper00033073 | |||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Mutants do not respond to touch on the tail | Paper_evidence | WBPaper00033073 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00033073 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0001221 | Paper_evidence | WBPaper00033073 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Mutants do not respond to touch on the head | Paper_evidence | WBPaper00033073 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00033073 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0001315 | Paper_evidence | WBPaper00033073 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Genetic ablation of kht-1 results in decreased K+ flux compared to N2 | Paper_evidence | WBPaper00033073 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00033073 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0001316 | Paper_evidence | WBPaper00033073 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | In kht-1 nulls, currents inactivated with peak values roughly 20% smaller than those of the N2 current. The steady-state component of the current was markedly diminished | Paper_evidence | WBPaper00033073 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00033073 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0002469 | Paper_evidence | WBPaper00033073 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | During habituation attempts, animals were less receptive to taps than normal worms, as though they were already desensitized | Paper_evidence | WBPaper00033073 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00033073 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Phenotype_not_observed | WBPhenotype:0000816 | Paper_evidence | WBPaper00033073 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Null mutants did not show developmental or morphological abnormalities in neurons | Paper_evidence | WBPaper00033073 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00033073 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0000905 | Paper_evidence | WBPaper00033073 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Null mutants did not show developmental or morphological abnormalities in neurons | Paper_evidence | WBPaper00033073 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00033073 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Reference | WBPaper00033073 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |