WormBase Tree Display for Variation: WBVar00093122
expand all nodes | collapse all nodes | view schema
WBVar00093122 | Evidence | Paper_evidence | WBPaper00032243 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ok1927 | |||||||
Other_name | T22G5.5b.1:c.166_1101+14del | ||||||||
T22G5.5a.1:c.139_1074+14del | |||||||||
HGVSg | CHROMOSOME_V:g.13893597_13895181del | ||||||||
Sequence_details | SMap | S_parent | Sequence | T22G5 | |||||
Flanking_sequences | gtattttggcttgtccaattgaatattaca | gttttgaaaaattacgagcttgttccaata | |||||||
Mapping_target | T22G5 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | OK1927_external | ||||||||
OK1927_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00032275 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00011932 | |||||||
Transcript | T22G5.5a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | T22G5.5a.1:c.139_1074+14del | ||||||||
cDNA_position | 149-? | ||||||||
CDS_position | 139-? | ||||||||
Protein_position | 47-? | ||||||||
Intron_number | 3-7/11 | ||||||||
Exon_number | 3-7/12 | ||||||||
T22G5.5b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | T22G5.5b.1:c.166_1101+14del | ||||||||
cDNA_position | 166-? | ||||||||
CDS_position | 166-? | ||||||||
Protein_position | 56-? | ||||||||
Intron_number | 3-7/10 | ||||||||
Exon_number | 3-7/11 | ||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype_not_observed | WBPhenotype:0002541 | Paper_evidence | WBPaper00032243 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Radiation-induced germ cell apoptosis was not inhibited. | Paper_evidence | WBPaper00032243 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005784 | PATO:0000460 | Paper_evidence | WBPaper00032243 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | At least 20 animals were scored for germ cell apoptosis at 36 hours post-120 Gy and compared to WT-irradiated controls. | Paper_evidence | WBPaper00032243 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00032243 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |