WormBase Tree Display for Variation: WBVar00093128
expand all nodes | collapse all nodes | view schema
| WBVar00093128 | Name | Public_name | ok1933 | ||
|---|---|---|---|---|---|
| HGVSg | CHROMOSOME_X:g.163361_165572del | ||||
| Sequence_details | SMap | S_parent | Sequence | T08D2 | |
| Flanking_sequences | acactttccggcccgaaaaatcttaatttt | ttttgtaccaaaatttgagttttaatataa | |||
| Mapping_target | T08D2 | ||||
| Type_of_mutation | Deletion | ||||
| PCR_product | OK1933_external | ||||
| OK1933_internal | |||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00032276 | ||||
| Laboratory | RB | ||||
| Person | WBPerson46 | ||||
| KO_consortium_allele | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00011607 | |||
| Pseudogene | T08D2.2 | VEP_consequence | splice_donor_variant,non_coding_transcript_exon_variant,intron_variant | ||
| VEP_impact | HIGH | ||||
| Intron_number | 1/5 | ||||
| Exon_number | 1/6 | ||||
| Isolation | Mutagen | UV/TMP | |||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00011607 Genomic_neighbourhood | |||||
| Method | KO_consortium_allele |
