WormBase Tree Display for Variation: WBVar00093142
expand all nodes | collapse all nodes | view schema
WBVar00093142 | Name | Public_name | ok1947 | ||
---|---|---|---|---|---|
Other_name | F46G10.6.1:c.93+6_*187del | ||||
HGVSg | CHROMOSOME_X:g.13349738_13350692del | ||||
Sequence_details | SMap | S_parent | Sequence | C49F8 | |
Flanking_sequences | caaatcagtgagtaaaaaaaactgaaataa | cttacatcggaagaatccgagtgatggcgt | |||
Mapping_target | C49F8 | ||||
Type_of_mutation | Deletion | ||||
PCR_product | ok1947_external | ||||
ok1947_internal | |||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00032284 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00003511 | |||
Transcript | F46G10.6.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
HGVSc | F46G10.6.1:c.93+6_*187del | ||||
cDNA_position | ?-909 | ||||
Intron_number | 2-4/5 | ||||
Exon_number | 3-6/6 | ||||
Interactor | WBInteraction000520071 | ||||
WBInteraction000520072 | |||||
WBInteraction000520073 | |||||
WBInteraction000520074 | |||||
Isolation | Mutagen | EMS | |||
Disease_info | Models_disease | DOID:9351 | |||
Models_disease_in_annotation | WBDOannot00000509 | ||||
WBDOannot00000510 | |||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||
Longevity phenotype to be tested in FUdR 100g/ml. Ahringer library lacks mxl-3 RNAi clone. Request from O'Rourke lab if needed. | Person_evidence | WBPerson3759 | |||
Method | KO_consortium_allele |