WormBase Tree Display for Variation: WBVar00093144

WBVar00093144 Name: Public_name: ok1949
    HGVSg: CHROMOSOME_V:g.8224777_8225941delinsTAAATCATTAAAA
  Sequence_details: SMap: S_parent: Sequence: K07C11
    Flanking_sequences: aaccaacaatcatattcccaccggctggtt aatgaattaaatcaaatttctggaaatctt
    Mapping_target: K07C11
    Type_of_mutation: Insertion: TAAATCATTAAAA
      Deletion
    PCR_product: ok1949_external
      ok1949_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00032286
    Laboratory: RB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00003937
    Transcript: K07C11.1.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-709
        CDS_position: ?-678
        Protein_position: ?-226
        Intron_number: 2-3/4
        Exon_number: 1-4/5
  Isolation: Mutagen: EMS
  Description: Phenotype: WBPhenotype:0001013 Paper_evidence: WBPaper00041163
        Curator_confirmed: WBPerson2987
        Remark: "We tested whether or not these transcriptional factors are required for the C. elegans' defense against V. cholerae using mutants and RNAi of these genes in lethality assay. Three genes, pax-1, nhr-23 and nhr-234, were tested for their contribution to the organisms response to infection. We found that the nhr-23 RNAi and the pax-1(ok1949) mutants exhibited increased lethality, suggesting that these genes induce the immune response in C. elegans (Fig. 4)." Paper_evidence: WBPaper00041163
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Treatment: Animals were exposed to Vibrio cholerae and assayed for survival over time Paper_evidence: WBPaper00041163
              Curator_confirmed: WBPerson2987
  Reference: WBPaper00041163
  Remark: Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele