WormBase Tree Display for Variation: WBVar00093153
expand all nodes | collapse all nodes | view schema
| WBVar00093153 | Evidence | Paper_evidence | WBPaper00038487 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | ok1958 | |||||
| Other_name | M01E11.6.1:c.588_*12delinsCTATTCTAACATTTCATGTAAA | ||||||
| HGVSg | CHROMOSOME_I:g.5577181_5578463delinsTTTACATGAAATGTTAGAATAG | ||||||
| Sequence_details | SMap | S_parent | Sequence | M01E11 | |||
| Flanking_sequences | ataacgttattttacatgaaatgttagaat | agtgaaatcagcttgcgatccgctccttca | |||||
| Mapping_target | M01E11 | ||||||
| Type_of_mutation | Insertion | TTTACATGAAATGTTAGAATAG | |||||
| Deletion | |||||||
| PCR_product | ok1958_external | ||||||
| ok1958_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00032289 | ||||||
| WBStrain00050671 | |||||||
| WBStrain00050674 | |||||||
| Laboratory | RB | ||||||
| Person | WBPerson46 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00002225 | |||||
| Transcript | M01E11.6.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | M01E11.6.1:c.588_*12delinsCTATTCTAACATTTCATGTAAA | ||||||
| cDNA_position | 601-1789 | ||||||
| CDS_position | 588-? | ||||||
| Protein_position | 196-? | ||||||
| Intron_number | 3-4/5 | ||||||
| Exon_number | 3-6/6 | ||||||
| Isolation | Mutagen | EMS | |||||
| Description | Phenotype | WBPhenotype:0002469 | Paper_evidence | WBPaper00038487 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Animals exhibited a loss of habituation in response to continued plate taps applied with a 10s interval, unlike N2 animals. | Paper_evidence | WBPaper00038487 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0004027 | Paper_evidence | WBPaper00038487 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Animals exhibit a higher probability of escape responses (reversal) compared to N2 animals upon an initial plate tap. | Paper_evidence | WBPaper00038487 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00038487 | ||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
| Method | KO_consortium_allele |
