WormBase Tree Display for Variation: WBVar00093177
expand all nodes | collapse all nodes | view schema
WBVar00093177 | Name | Public_name | ok1983 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE30998:p.Ala252TrpfsTer7 | ||||||||
F52C9.8a.4:c.754_2032del | |||||||||
F52C9.8c.1:c.285+852_286-1395del | |||||||||
F52C9.8a.2:c.754_2032del | |||||||||
F52C9.8g.1:c.285+852_286-1395del | |||||||||
F52C9.8a.3:c.754_2032del | |||||||||
CE30802:p.Ala252TrpfsTer7 | |||||||||
F52C9.8b.1:c.754_2032del | |||||||||
F52C9.8a.1:c.754_2032del | |||||||||
HGVSg | CHROMOSOME_III:g.5312989_5314318del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F52C9 | |||||
Flanking_sequences | ACATACTGGAGCTGCTCCTGCTTCTCGAATG | tggcgccgaatacgattttgattagcgcga | |||||||
Mapping_target | F52C9 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | OK1983_external | ||||||||
OK1983_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00032306 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004095 | |||||||
Transcript | F52C9.8a.3 (11) | ||||||||
F52C9.8a.2 (11) | |||||||||
F52C9.8a.4 (11) | |||||||||
F52C9.8c.1 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | F52C9.8c.1:c.285+852_286-1395del | ||||||||
Intron_number | 5/11 | ||||||||
F52C9.8g.1 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | F52C9.8g.1:c.285+852_286-1395del | ||||||||
Intron_number | 5/11 | ||||||||
F52C9.8a.1 (11) | |||||||||
F52C9.8b.1 (11) | |||||||||
Interactor | WBInteraction000520945 | ||||||||
WBInteraction000571535 | |||||||||
WBInteraction000571536 | |||||||||
WBInteraction000571537 | |||||||||
WBInteraction000571538 | |||||||||
WBInteraction000571539 | |||||||||
WBInteraction000571540 | |||||||||
Isolation | Mutagen | EMS | |||||||
Description | Phenotype | WBPhenotype:0001276 | Paper_evidence | WBPaper00044613 | |||||
Curator_confirmed | WBPerson24243 | ||||||||
Remark | VC1, VC2, VC3, and VC6 express the VC4/5-specific gene unc-4. uIs45 [unc-4p::MDM2::GFP] was used as the reporter for unc-4 expression. | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004621 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||
Curator_confirmed | WBPerson24243 | ||||||||
WBbt:0004619 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
WBbt:0004618 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
WBbt:0004611 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
Phenotype_assay | Genotype | uIs45 [unc-4p::MDM2::GFP] | Paper_evidence | WBPaper00044613 | |||||
Curator_confirmed | WBPerson24243 | ||||||||
WBPhenotype:0001510 | Paper_evidence | WBPaper00044613 | |||||||
Curator_confirmed | WBPerson24243 | ||||||||
Remark | VC1, VC2, VC3, and VC6 express the VC4/5-specific gene unc-4. uIs45 [unc-4p::MDM2::GFP] was used as the reporter for unc-4 expression. | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004621 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||
Curator_confirmed | WBPerson24243 | ||||||||
WBbt:0004619 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
WBbt:0004618 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
WBbt:0004611 | PATO:0000460 | Paper_evidence | WBPaper00044613 | ||||||
Curator_confirmed | WBPerson24243 | ||||||||
Phenotype_assay | Genotype | uIs45 [unc-4p::MDM2::GFP] | Paper_evidence | WBPaper00044613 | |||||
Curator_confirmed | WBPerson24243 | ||||||||
Reference | WBPaper00044613 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |