WormBase Tree Display for Variation: WBVar00093210
expand all nodes | collapse all nodes | view schema
WBVar00093210 | Evidence | Paper_evidence | WBPaper00038487 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ok2020 | |||||
Other_name | Y92C3B.3a.2:c.80_*813del | ||||||
Y92C3B.3b.2:c.161_*813del | |||||||
HGVSg | CHROMOSOME_III:g.1078869_1080184del | ||||||
Sequence_details | SMap | S_parent | Sequence | Y92C3B | |||
Flanking_sequences | ggcaattttaagccaaaattggtatttttg | ccattgaagttacgcggaaatccacgccta | |||||
Mapping_target | Y92C3B | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | OK2020_external | ||||||
OK2020_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00032332 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00004277 | |||||
Transcript | Y92C3B.3b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
cDNA_position | 161-? | ||||||
CDS_position | 161-? | ||||||
Protein_position | 54-? | ||||||
Intron_number | 3/4 | ||||||
Exon_number | 3-5/5 | ||||||
Y92C3B.3b.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | Y92C3B.3b.2:c.161_*813del | ||||||
cDNA_position | 302-1566 | ||||||
CDS_position | 161-? | ||||||
Protein_position | 54-? | ||||||
Intron_number | 4/5 | ||||||
Exon_number | 4-6/6 | ||||||
Y92C3B.3a.2 | VEP_consequence | stop_lost,3_prime_UTR_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | Y92C3B.3a.2:c.80_*813del | ||||||
cDNA_position | 163-1478 | ||||||
CDS_position | 80-? | ||||||
Protein_position | 27-? | ||||||
Exon_number | 4-5/5 | ||||||
Y92C3B.3a.1 | VEP_consequence | coding_sequence_variant,3_prime_UTR_variant | |||||
VEP_impact | MODIFIER | ||||||
cDNA_position | 84-? | ||||||
CDS_position | 80-? | ||||||
Protein_position | 27-? | ||||||
Exon_number | 3/3 | ||||||
Isolation | Mutagen | UV/TMP | |||||
Description | Phenotype | WBPhenotype:0000031 | Paper_evidence | WBPaper00058991 | |||
Curator_confirmed | WBPerson712 | ||||||
Image | WBPicture0000014942 | Paper_evidence | WBPaper00058991 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001183 | Paper_evidence | WBPaper00058991 | |||||
Curator_confirmed | WBPerson712 | ||||||
Image | WBPicture0000014942 | Paper_evidence | WBPaper00058991 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0004027 | Paper_evidence | WBPaper00038487 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals exhibit a higher probability of escape responses (reversal) compared to N2 animals upon an initial plate tap. | Paper_evidence | WBPaper00038487 | ||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00058991 | ||||
Curator_confirmed | WBPerson712 | ||||||
Image | WBPicture0000014942 | Paper_evidence | WBPaper00058991 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000145 | Paper_evidence | WBPaper00058991 | |||||
Curator_confirmed | WBPerson712 | ||||||
Image | WBPicture0000014942 | Paper_evidence | WBPaper00058991 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0002469 | Paper_evidence | WBPaper00038487 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | The probability and size of response to plate taps decreased with continued taps applied with a 10s interval, similar to the response of N2 animals. | Paper_evidence | WBPaper00038487 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00038487 | ||||||
WBPaper00058991 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |