WormBase Tree Display for Variation: WBVar00093308
expand all nodes | collapse all nodes | view schema
WBVar00093308 | Evidence | Paper_evidence | WBPaper00038341 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ok2129 | |||||
HGVSg | CHROMOSOME_II:g.8429952_8431717del | ||||||
Sequence_details | SMap | S_parent | Sequence | F14E5 | |||
Flanking_sequences | tttttccatcgaaaccacaatttatacttg | tttgcaagataagcaggatcgctgagacta | |||||
Mapping_target | F14E5 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | ok2129_external | ||||||
ok2129_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00032397 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00008802 | |||||
Transcript | F14E5.4.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
cDNA_position | 248-? | ||||||
CDS_position | 153-? | ||||||
Protein_position | 51-? | ||||||
Intron_number | 4-10/11 | ||||||
Exon_number | 4-12/12 | ||||||
F14E5.4.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
cDNA_position | 170-? | ||||||
CDS_position | 153-? | ||||||
Protein_position | 51-? | ||||||
Intron_number | 3-9/10 | ||||||
Exon_number | 3-11/11 | ||||||
Isolation | Mutagen | EMS | |||||
Description | Phenotype | WBPhenotype:0002469 | Paper_evidence | WBPaper00041802 | |||
Curator_confirmed | WBPerson3192 | ||||||
Phenotype_not_observed | WBPhenotype:0000047 | Paper_evidence | WBPaper00038341 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Endodermal precursors became internalized at the 2E stage, as in wildtype embryos. | Paper_evidence | WBPaper00038341 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00038341 | ||||||
WBPaper00041802 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |