WormBase Tree Display for Variation: WBVar00093355
expand all nodes | collapse all nodes | view schema
| WBVar00093355 | Name (3) | ||||||
|---|---|---|---|---|---|---|---|
| Sequence_details | SMap | S_parent | Sequence | Y71G12B | |||
| Flanking_sequences | tgggattgtggagaaatgaataagccggat | ttgtccgtgtagagtacacgactttcccag | |||||
| Mapping_target | Y71G12B | ||||||
| Type_of_mutation | Deletion | ||||||
| PCR_product | ok2189_external | ||||||
| ok2189_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00032413 | ||||||
| Laboratory | RB | ||||||
| Person | WBPerson46 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects (2) | |||||||
| Isolation | Mutagen | EMS | |||||
| Description | Phenotype | WBPhenotype:0001758 | Paper_evidence | WBPaper00053772 | |||
| Curator_confirmed | WBPerson40249 | ||||||
| Remark | Reduced number of mature C-terminally amidated neuropeptides, with a higher prevalency of the unprocessed glycine-extended neuropeptides. PGHM-1 is considered as a part of the neuropeptide amidation machinery in C. elegans | Paper_evidence | WBPaper00053772 | ||||
| Curator_confirmed | WBPerson40249 | ||||||
| Reference | WBPaper00053772 | ||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
| Method | KO_consortium_allele |
