WormBase Tree Display for Variation: WBVar00093393
expand all nodes | collapse all nodes | view schema
WBVar00093393 | Name | Public_name | ok2229 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y67A10A.8b.1:c.343-43_796delinsA | |||||||
Y67A10A.8a.1:c.481-43_934delinsA | ||||||||
HGVSg | CHROMOSOME_IV:g.14380184_14381705delinsT | |||||||
Sequence_details | SMap | S_parent | Sequence | Y67A10A | ||||
Flanking_sequences | aattggaattgactgaagaagaagagattt | cactaaaatgtttacaatttttgtgtttct | ||||||
Mapping_target | Y67A10A | |||||||
Type_of_mutation | Insertion | T | ||||||
Deletion | ||||||||
PCR_product | ok2229_external | |||||||
ok2229_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031176 | |||||||
WBStrain00032435 | ||||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00170763 | ||||||
WBGene00164999 | ||||||||
WBGene00172726 | ||||||||
WBGene00013457 | ||||||||
WBGene00049818 | ||||||||
WBGene00046184 | ||||||||
Transcript | Y67A10A.296 | |||||||
Y67A10A.8b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y67A10A.8b.1:c.343-43_796delinsA | |||||||
cDNA_position | ?-796 | |||||||
CDS_position | ?-796 | |||||||
Protein_position | ?-266 | |||||||
Intron_number | 2-5/5 | |||||||
Exon_number | 3-6/6 | |||||||
Y67A10A.146 | ||||||||
Y67A10A.32 | ||||||||
Y67A10A.119 | ||||||||
Y67A10A.8a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y67A10A.8a.1:c.481-43_934delinsA | |||||||
cDNA_position | ?-936 | |||||||
CDS_position | ?-934 | |||||||
Protein_position | ?-312 | |||||||
Intron_number | 4-7/8 | |||||||
Exon_number | 5-8/9 | |||||||
Y67A10A.256 | ||||||||
Interactor | WBInteraction000535440 | |||||||
WBInteraction000535454 | ||||||||
WBInteraction000535456 | ||||||||
WBInteraction000535458 | ||||||||
WBInteraction000535459 | ||||||||
WBInteraction000535460 | ||||||||
Isolation | Mutagen | EMS | ||||||
Description | Phenotype | WBPhenotype:0000154 | Paper_evidence | WBPaper00039827 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001213 | Paper_evidence | WBPaper00039827 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | speed of locomotion is slower than wild type animals | Paper_evidence | WBPaper00039827 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001485 | Paper_evidence | WBPaper00051473 | ||||||
Curator_confirmed | WBPerson38423 | |||||||
Remark | more sensitive to conditions ER stress induced by tunicamycin (figure 1A and supplementary figure S1) | Paper_evidence | WBPaper00051473 | |||||
Curator_confirmed | WBPerson38423 | |||||||
Phenotype_assay | Strain | WBStrain00031176 | Paper_evidence | WBPaper00051473 | ||||
Curator_confirmed | WBPerson38423 | |||||||
Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00051473 | |||||
Curator_confirmed | WBPerson38423 | |||||||
Phenotype_not_observed | WBPhenotype:0000032 | Paper_evidence | WBPaper00039827 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | mutants are healthy | Paper_evidence | WBPaper00039827 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000073 | Paper_evidence | WBPaper00039827 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000138 | Paper_evidence | WBPaper00039827 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | none of the single mutants showed a significant difference in their lipid content compared to wild type | Paper_evidence | WBPaper00039827 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | daf-2(e1370) | Paper_evidence | WBPaper00039827 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000145 | Paper_evidence | WBPaper00039827 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | mutants made it to 100% fertile adults at all temperatures | Paper_evidence | WBPaper00039827 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000308 | Paper_evidence | WBPaper00039827 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | animals do not show any defects in entry or exit from dauer | Paper_evidence | WBPaper00039827 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | daf-2(e1370) | Paper_evidence | WBPaper00039827 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000725 | Paper_evidence | WBPaper00039827 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | fatty acid composition is not different from wt | Paper_evidence | WBPaper00039827 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001453 | Paper_evidence | WBPaper00039827 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | animals do not show any defects in high osmolarity avoidance behavior | Paper_evidence | WBPaper00039827 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00039827 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001472 | Paper_evidence | WBPaper00039827 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00001063 | Paper_evidence | WBPaper00039827 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001888 | Paper_evidence | WBPaper00039827 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | lipid droplet size was not different than wt | Paper_evidence | WBPaper00039827 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00039827 | |||||||
WBPaper00051473 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |