WormBase Tree Display for Variation: WBVar00093403
expand all nodes | collapse all nodes | view schema
WBVar00093403 | Name | Public_name | ok2239 | ||||||
---|---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_III:g.7362292_7363266del | ||||||||
Sequence_details | SMap | S_parent | Sequence | F08F8 | |||||
Flanking_sequences | cgtaaatgaaaacaaattttgatggagatt | ctgagacattgaaatcaaatttcctttgtc | |||||||
Mapping_target | F08F8 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok2239_external | ||||||||
ok2239_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00032440 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00017270 | |||||||
Transcript | F08F8.5.1 | VEP_consequence | coding_sequence_variant,3_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | ||||||||
cDNA_position | 199-? | ||||||||
CDS_position | 199-? | ||||||||
Protein_position | 67-? | ||||||||
Exon_number | 1/1 | ||||||||
Isolation | Mutagen | EMS | |||||||
Description | Phenotype | WBPhenotype:0000007 | Paper_evidence | WBPaper00036303 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | numr-1(ok2239) nematodes were egg-laying defective (Egl phenotype). This was demonstrated by an increase in the number of nematodes with a "bagging" phenotype, where nematodes fail to lay their eggs and embryos hatch inside the parent (Figure 6). | Paper_evidence | WBPaper00036303 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000695 | Paper_evidence | WBPaper00036303 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Microscopic examination of the vulva in L4 numr-1(ok2239) nematodes showed that there were structural abnormalities, which may have contributed to the Egl phenotype (Figure 6). numr-1(ok2239) nematodes often lacked organized epithelial-ring structures that line the vulva lumen at the L4 stage. | Paper_evidence | WBPaper00036303 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006748 | PATO:0000460 | Paper_evidence | WBPaper00036303 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00036303 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001655 | Paper_evidence | WBPaper00036303 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | RNAi-treated numr-1(ok2239) C. elegans that were exposed to 100 μM cadmium had a significantly reduced lifespan, compared with numr-1/-2 RNAi-treated wild-type nematodes (P = 0.0001; Figure 8). | Paper_evidence | WBPaper00036303 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002241 | Paper_evidence | WBPaper00036303 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | numr-1(ok2239) nematodes did not feed as much (i.e. Eat phenotype) as the wild-type nematodes (Figure 6). | Paper_evidence | WBPaper00036303 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Briefly, 25 adult C. elegans were dispensed into each well of a 96-well plate, containing K-medium and OP50 E. coli, using a COPAS Biosort (Union Biometrica Inc., Somerville, MA, USA). After 4 hours, Fluoresbrite polychromatic red microspheres (Polysciences, Inc., Warrington, PA) were added into each well and mixed for 5 minutes. Nematodes were allowed to ingest the microspheres for 10 additional minutes and then anesthetized by adding sodium azide (10 millimolar final concentration) to prevent additional bead ingestion. The size and level of fluorescence of individual C. elegans were measured. | Paper_evidence | WBPaper00036303 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0001653 | Paper_evidence | WBPaper00036303 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Treatment of numr-1(ok2239) with cadmium did not significantly affect longevity, relative to wild-type nematodes. This may have been due to the presence of the intact numr-2 and continued NUMR-2 expression. | Paper_evidence | WBPaper00036303 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00036303 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |