WormBase Tree Display for Variation: WBVar00093420
expand all nodes | collapse all nodes | view schema
WBVar00093420 | Name | Public_name | ok2259 | ||
---|---|---|---|---|---|
Other_name | T22D1.9.1:c.185_1764+24del | ||||
HGVSg | CHROMOSOME_IV:g.6908009_6909659del | ||||
Sequence_details | SMap | S_parent | Sequence | T22D1 | |
Flanking_sequences | TATGAACAAGGGAATAGCCAAAACTCGAGG | ATGGCTTGTAAAGTGTTGTGTCCGGTTCAG | |||
Mapping_target | T22D1 | ||||
Type_of_mutation | Deletion | ||||
PCR_product | ok2259_external | ||||
ok2259_internal | |||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00036819 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00004458 | |||
Transcript | T22D1.9.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||
VEP_impact | HIGH | ||||
HGVSc | T22D1.9.1:c.185_1764+24del | ||||
cDNA_position | 194-? | ||||
CDS_position | 185-? | ||||
Protein_position | 62-? | ||||
Intron_number | 3-4/8 | ||||
Exon_number | 3-4/9 | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00061173 | ||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||
Method | KO_consortium_allele |