WormBase Tree Display for Variation: WBVar00093443

WBVar00093443 Name: Public_name: ok2283
    Other_name: Y52D3.1a.1:c.521+122_878-115del
    HGVSg: CHROMOSOME_III:g.10949491_10950505del
  Sequence_details: SMap: S_parent: Sequence: Y48A6A
    Flanking_sequences: ggagcaaaactgacgaaacttcgtatcaca tagggactctcttttctcaaaattggatct
    Mapping_target: Y48A6A
    Type_of_mutation: Deletion
    PCR_product: ok2283_external
      ok2283_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00032466
    Laboratory: RB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00013132
    Transcript: Y52D3.1a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y52D3.1a.1:c.521+122_878-115del
        Intron_number: 4-5/7
        Exon_number: 5/8
    Interactor: WBInteraction000504223
  Isolation: Mutagen: EMS
  Description: Phenotype_not_observed: WBPhenotype:0001540 Paper_evidence: WBPaper00032396
        Curator_confirmed: WBPerson2987
        Remark: strd-1(ok2283);daf-2(e1370) double mutant animals did not exhibit a significantly reduced dauer life span compared to control daf-2(e1370) mutant animals (Table 1) Paper_evidence: WBPaper00032396
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Treatment: C. elegans were synchronized and plated at 25 degrees Celsius. Three days later, ~10 dauer larvae were randomly picked into a 20 microliter drop of double-distilled water suspended under a Petri dish cover. A wet tissue was placed in the bottom of the dish to maintain humidity, and the plate was sealed with Parafilm. Dauer longevity was monitored daily, and survival was scored as moving response upon exposure to a focused beam of 425-440 nm light. Paper_evidence: WBPaper00032396
              Curator_confirmed: WBPerson2987
          Temperature: 25 Paper_evidence: WBPaper00032396
              Curator_confirmed: WBPerson2987
          Genotype: daf-2(e1370) Paper_evidence: WBPaper00032396
              Curator_confirmed: WBPerson2987
  Reference: WBPaper00032396
  Remark: Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele