WormBase Tree Display for Variation: WBVar00093475
expand all nodes | collapse all nodes | view schema
WBVar00093475 | Name | Public_name | ok2320 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE33849:p.Glu185_Ter547delinsAsp | |||||||
Y24D9A.2.1:c.555_1640del | ||||||||
HGVSg | CHROMOSOME_IV:g.4391484_4393087del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y24D9A | ||||
Flanking_sequences | tttgctggcagaacagggcacatcgacgga | cactcggtacgataaatggaacaaggatat | ||||||
Mapping_target | Y24D9A | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok2320_external | |||||||
ok2320_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00032484 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00021282 | ||||||
Transcript | Y24D9A.2.1 (11) | |||||||
Isolation | Mutagen | EMS | ||||||
Description | Phenotype | WBPhenotype:0000061 | Paper_evidence | WBPaper00064543 | ||||
Curator_confirmed | WBPerson6615 | |||||||
Remark | Figure1, the depletion of set-21 extends lifespan in daf-2 mutant. | Paper_evidence | WBPaper00064543 | |||||
Curator_confirmed | WBPerson6615 | |||||||
Phenotype_assay | Genotype | daf-2(e1370) | Paper_evidence | WBPaper00064543 | ||||
Curator_confirmed | WBPerson6615 | |||||||
Reference | WBPaper00064543 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |