WormBase Tree Display for Variation: WBVar00093547
expand all nodes | collapse all nodes | view schema
WBVar00093547 | Name | Public_name | ok2398 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | ZK507.4.1:c.100_518+83del | |||||||
HGVSg | CHROMOSOME_III:g.9104177_9105850del | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK507 | ||||
Flanking_sequences | tcgtttgaatcccaccattcagaacccagg | aaagaaatcgcaaaagacgcaccccaatct | ||||||
Mapping_target | ZK507 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok2398_external | |||||||
ok2398_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00032542 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00013980 | ||||||
WBGene00196670 | ||||||||
WBGene00014624 | ||||||||
Transcript | ZK507.7 | VEP_consequence | non_coding_transcript_exon_variant | |||||
VEP_impact | MODIFIER | |||||||
cDNA_position | 40-? | |||||||
Exon_number | 1/1 | |||||||
ZK507.4.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | ZK507.4.1:c.100_518+83del | |||||||
cDNA_position | 235-? | |||||||
CDS_position | 100-? | |||||||
Protein_position | 34-? | |||||||
Intron_number | 2-6/8 | |||||||
Exon_number | 2-6/9 | |||||||
ZK507.t1 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
Isolation | Mutagen | EMS | ||||||
Description | Phenotype | WBPhenotype:0000412 | Paper_evidence | WBPaper00038400 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals took significantly more time to respond to octanol (initiate backwards movement) than WT controls; however, this defect in response time was mild compared to osm-11(rt142) and osm-7(tm2256) null mutants. | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00038400 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00001966 | Paper_evidence | WBPaper00038400 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0001096 | Paper_evidence | WBPaper00032102 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032102 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | ayIs4 | Paper_evidence | WBPaper00032102 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00038400 | |||||||
WBPaper00032102 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |