WormBase Tree Display for Variation: WBVar00093663
expand all nodes | collapse all nodes | view schema
| WBVar00093663 | Name | Public_name | ok2531 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Other_name | C07G1.1.1:c.916_1158+103del | ||||||||
| HGVSg | CHROMOSOME_IV:g.8208298_8208643del | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C07G1 | |||||
| Flanking_sequences | ttatcccaatgttacattccaccatgtcca | cttctgctctaactagctatttctatttta | |||||||
| Mapping_target | C07G1 | ||||||||
| Type_of_mutation | Deletion | ||||||||
| PCR_product | OK2531_external | ||||||||
| OK2531_internal | |||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00037136 | ||||||||
| Laboratory | RB | ||||||||
| Person | WBPerson46 | ||||||||
| KO_consortium_allele | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00006620 | |||||||
| Transcript | C07G1.1.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | C07G1.1.1:c.916_1158+103del | ||||||||
| cDNA_position | 1051-? | ||||||||
| CDS_position | 916-? | ||||||||
| Protein_position | 306-? | ||||||||
| Intron_number | 7/17 | ||||||||
| Exon_number | 7/18 | ||||||||
| Interactor | WBInteraction000517418 | ||||||||
| WBInteraction000524607 | |||||||||
| WBInteraction000524608 | |||||||||
| WBInteraction000578997 | |||||||||
| Isolation | Mutagen | EMS | |||||||
| Description | Phenotype | WBPhenotype:0000059 | Paper_evidence | WBPaper00046103 | |||||
| Curator_confirmed | WBPerson1068 | ||||||||
| WBPhenotype:0000685 | Paper_evidence | WBPaper00046103 | |||||||
| Curator_confirmed | WBPerson557 | ||||||||
| Remark | svh-1(ok2531) homozygous mutants failed to grow larger than the L2 larva body size even after 5 days following hatching. | Paper_evidence | WBPaper00046103 | ||||||
| Curator_confirmed | WBPerson557 | ||||||||
| WBPhenotype:0000980 | Paper_evidence | WBPaper00046103 | |||||||
| Curator_confirmed | WBPerson557 | ||||||||
| Remark | In svh-1(ok2531) mutants, although the frequency of pharyngeal pumping appeared normal just after hatching, pharyngeal muscle contraction became irregular and the pumping frequency greatly decreased by 48 hours after hatching. | Paper_evidence | WBPaper00046103 | ||||||
| Curator_confirmed | WBPerson557 | ||||||||
| WBPhenotype:0001006 | Paper_evidence | WBPaper00046103 | |||||||
| Curator_confirmed | WBPerson557 | ||||||||
| Remark | In svh-1(ok2531) mutants, although the frequency of pharyngeal pumping appeared normal just after hatching, pharyngeal muscle contraction became irregular and the pumping frequency greatly decreased by 48 hours after hatching. | Paper_evidence | WBPaper00046103 | ||||||
| Curator_confirmed | WBPerson557 | ||||||||
| WBPhenotype:0001911 | Paper_evidence | WBPaper00040839 | |||||||
| Curator_confirmed | WBPerson1068 | ||||||||
| Remark | Axon regeneration phenotype was observed in svh-1(ok2531); kmDp1 background. | Paper_evidence | WBPaper00040839 | ||||||
| Curator_confirmed | WBPerson1068 | ||||||||
| EQ_annotations | GO_term | GO:0031103 | PATO:0001511 | Paper_evidence | WBPaper00040839 | ||||
| Curator_confirmed | WBPerson1068 | ||||||||
| Phenotype_assay | Genotype | kmDp1 | Paper_evidence | WBPaper00040839 | |||||
| Curator_confirmed | WBPerson1068 | ||||||||
| Reference | WBPaper00040839 | ||||||||
| WBPaper00046103 | |||||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
| Method | KO_consortium_allele |
