WormBase Tree Display for Variation: WBVar00093668
expand all nodes | collapse all nodes | view schema
| WBVar00093668 | Name | Public_name | ok2536 | ||
|---|---|---|---|---|---|
| HGVSg | CHROMOSOME_II:g.1322519_1323194del | ||||
| Sequence_details | SMap | S_parent | Sequence | F56D12 | |
| Flanking_sequences | aggtcatggaggacgcaacaacactccatt | aaaacggtctaaaccaaccacaggggcgtg | |||
| Mapping_target | F56D12 | ||||
| Type_of_mutation | Deletion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00032618 | ||||
| Laboratory | RB | ||||
| KO_consortium_allele | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00197171 | |||
| WBGene00006924 | |||||
| Transcript | F56D12.10 | VEP_consequence | transcript_ablation | ||
| VEP_impact | HIGH | ||||
| Exon_number | 1/1 | ||||
| F56D12.5.1 | VEP_consequence | coding_sequence_variant,3_prime_UTR_variant | |||
| VEP_impact | MODIFIER | ||||
| cDNA_position | 1206-? | ||||
| CDS_position | 1095-? | ||||
| Protein_position | 365-? | ||||
| Exon_number | 6-7/7 | ||||
| Interactor | WBInteraction000520822 | ||||
| Remark | A 676bp long deletion covering only a small part of the coding region of vig-1. The deletion leads to a frame shift mutation replacing the last 14 amino acids of the protein with 17 alternative ones and deleting the whole of the predicted 3'-UTR. | Person_evidence | WBPerson6488 | ||
| Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
| Method | KO_consortium_allele |
