WormBase Tree Display for Variation: WBVar00093704
expand all nodes | collapse all nodes | view schema
WBVar00093704 | Evidence | Paper_evidence | WBPaper00036066 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ok2581 | |||||||
Other_name | C09E8.3.1:c.1000-15_1504delinsC | ||||||||
HGVSg | CHROMOSOME_II:g.549553_551323delinsC | ||||||||
Sequence_details | SMap | S_parent | Sequence | C09E8 | |||||
Flanking_sequences | ccacaaatctcccagtacaaagtacaaatt | tccgagttgctcgccgagccgacatcgtct | |||||||
Mapping_target | C09E8 | ||||||||
Type_of_mutation | Insertion | C | |||||||
Deletion | |||||||||
PCR_product | ok2581_external | ||||||||
ok2581_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00032646 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00015646 | |||||||
Transcript | C09E8.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C09E8.3.1:c.1000-15_1504delinsC | ||||||||
cDNA_position | ?-1630 | ||||||||
CDS_position | ?-1504 | ||||||||
Protein_position | ?-502 | ||||||||
Intron_number | 5-8/9 | ||||||||
Exon_number | 6-9/10 | ||||||||
Isolation | Mutagen | EMS | |||||||
Description | Phenotype | WBPhenotype:0000137 | Paper_evidence | WBPaper00036066 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Transcripts of mlt-10 were less abundant in ok2581 mutants than wild-type animals | Paper_evidence | WBPaper00036066 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00036066 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00036066 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | COL-19::GFP macromolecules were disorganized in many mlt-10(ok2581) animals | Paper_evidence | WBPaper00036066 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00036066 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000638 | Paper_evidence | WBPaper00036066 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Buccal caps were observed on the majority of mlt-10(ok2581) mutants compared to 20% of wild-type larvae. When cultured on low cholesterol media, 92% of mlt-10(ok2581) mutants failed to shed the fourth larval cuticle, compared to 29% of wild-type animals | Paper_evidence | WBPaper00036066 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00036066 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000899 | Paper_evidence | WBPaper00036066 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Seam cells were misshapen and overlapped their sisters in mlt-10 mutants | Paper_evidence | WBPaper00036066 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00036066 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005753 | PATO:0000460 | Paper_evidence | WBPaper00036066 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001095 | Paper_evidence | WBPaper00036066 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The survival rate of various mlt-10 mutants was significantly lower than that of wild-type animals on media containing 300 mM NaCl | Paper_evidence | WBPaper00036066 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00036066 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001211 | Paper_evidence | WBPaper00036066 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants were all more permeable to Hoechst than wild-type larvae (porous cuticles) | Paper_evidence | WBPaper00036066 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00036066 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00036066 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Segments of the alae were broken, branched, or comprised of four ridges | Paper_evidence | WBPaper00036066 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00036066 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001834 | Paper_evidence | WBPaper00036066 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Transcripts of mlt-10 were shorter in ok2581 mutants than wild-type animals | Paper_evidence | WBPaper00036066 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00036066 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00036066 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |