WormBase Tree Display for Variation: WBVar00093726
expand all nodes | collapse all nodes | view schema
WBVar00093726 | Name | Public_name | ok2611 | ||||
---|---|---|---|---|---|---|---|
Other_name (17) | |||||||
HGVSg | CHROMOSOME_IV:g.360523_362285del | ||||||
Sequence_details | SMap | S_parent | Sequence | Y66H1B | |||
Flanking_sequences | ttaaaaatattgagtttcaacaattttaca | atcgcgtagactcctggttctgttggagtg | |||||
Mapping_target | Y66H1B | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | ok2611_external | ||||||
ok2611_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00032661 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00022048 | |||||
Transcript (17) | |||||||
Isolation | Mutagen | EMS | |||||
Description | Phenotype_not_observed | WBPhenotype:0000673 | Paper_evidence | WBPaper00037051 | |||
Curator_confirmed | WBPerson1777 | ||||||
Remark | No brood size defect present | Paper_evidence | WBPaper00037051 | ||||
Curator_confirmed | WBPerson1777 | ||||||
WBPhenotype:0000983 | Paper_evidence | WBPaper00037051 | |||||
Curator_confirmed | WBPerson1777 | ||||||
Remark | Results suggest this fln-1 allele is not required for the function of filamin in fertility | Paper_evidence | WBPaper00037051 | ||||
Curator_confirmed | WBPerson1777 | ||||||
Reference | WBPaper00037051 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |