WormBase Tree Display for Variation: WBVar00093747
expand all nodes | collapse all nodes | view schema
WBVar00093747 | Name | Public_name | ok2632 | ||||
---|---|---|---|---|---|---|---|
Other_name | CE52637:p.Leu297SerfsTer18 | ||||||
C25H3.11c.1:c.890_2328del | |||||||
CE52496:p.Leu297SerfsTer18 | |||||||
CE52490:p.Leu297SerfsTer18 | |||||||
C25H3.11b.1:c.890_2328del | |||||||
C25H3.11d.1:c.890_2328del | |||||||
C25H3.11a.1:c.890_2328del | |||||||
CE52475:p.Leu297SerfsTer18 | |||||||
HGVSg | CHROMOSOME_II:g.5685407_5687146del | ||||||
Sequence_details | SMap | S_parent | Sequence | C25H3 | |||
Flanking_sequences | ctctcctggttcccatattgtagttggacg | actgtgtcatctgatgcctcgtcaattcta | |||||
Mapping_target | C25H3 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | ok2632_external | ||||||
ok2632_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00037022 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00016120 | |||||
Transcript | C25H3.11d.1 (11) | ||||||
C25H3.11a.1 (11) | |||||||
C25H3.11c.1 (11) | |||||||
C25H3.11b.1 (11) | |||||||
Isolation | Mutagen | EMS | |||||
Description | Phenotype | WBPhenotype:0001236 | Paper_evidence | WBPaper00063999 | |||
Curator_confirmed | WBPerson557 | ||||||
Remark | Induction of the hsp-6p::GFP reporter is visible in the intestine of C25H3.11(ok2632) homozygous animals, but not in control animals. Induction of the hsp-6p::GFP reporter is a readout for the unfolded protein response in the mitochondria (UPRmt). | Paper_evidence | WBPaper00063999 | ||||
Curator_confirmed | WBPerson557 | ||||||
WBPhenotype:0001719 | Paper_evidence | WBPaper00063999 | |||||
Curator_confirmed | WBPerson557 | ||||||
Remark | Induction of the hsp-6p::GFP reporter is visible in the intestine of C25H3.11(ok2632) homozygous animals, but not in control animals. Induction of the hsp-6p::GFP reporter is a readout for the unfolded protein response in the mitochondria (UPRmt). | Paper_evidence | WBPaper00063999 | ||||
Curator_confirmed | WBPerson557 | ||||||
Reference | WBPaper00063999 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |