WormBase Tree Display for Variation: WBVar00093753
expand all nodes | collapse all nodes | view schema
WBVar00093753 | Name | Public_name | ok2642 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | W08D2.7.1:c.847_1873del | ||||||||
CE06562:p.Ala283LysfsTer25 | |||||||||
HGVSg | CHROMOSOME_IV:g.9826843_9828396del | ||||||||
Sequence_details | SMap | S_parent | Sequence | W08D2 | |||||
Flanking_sequences | cttaaaatatttttaacttcagaatgggtc | aaagaattattcaaattcaacgagaaccca | |||||||
Mapping_target | W08D2 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok2642_external | ||||||||
ok2642_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00032681 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00012342 | |||||||
Transcript | W08D2.7.1 (11) | ||||||||
Isolation | Mutagen | EMS | |||||||
Description | Phenotype | WBPhenotype:0002259 | Paper_evidence | WBPaper00046432 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants exhibit fewer dendritic termini and significantly fewer secondary and tertiary branches than controls. | Paper_evidence | WBPaper00046432 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006831 | PATO:0000460 | Paper_evidence | WBPaper00046432 | ||||
Curator_confirmed | WBPerson712 | ||||||||
GO_term | GO:0044292 | PATO:0001997 | Paper_evidence | WBPaper00046432 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00046432 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |