WormBase Tree Display for Variation: WBVar00093792
expand all nodes | collapse all nodes | view schema
| WBVar00093792 | Name | Public_name | ok2688 | ||
|---|---|---|---|---|---|
| Sequence_details | SMap | S_parent | Sequence | F48C11 | |
| Flanking_sequences | aacccaagttgctacaaatcatttgaaaca | tgcttacaatgaacaattgtgtcccggatt | |||
| Mapping_target | F48C11 | ||||
| Type_of_mutation | Deletion | ||||
| PCR_product | ok2688_external | ||||
| ok2688_internal | |||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00032714 | ||||
| Laboratory | RB | ||||
| Person | WBPerson46 | ||||
| KO_consortium_allele | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00003741 | |||
| Isolation | Mutagen | EMS | |||
| Description | Phenotype (17) | ||||
| Reference | WBPaper00043908 | ||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||
| Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003741 Genomic_neighbourhood | |||||
| Method | KO_consortium_allele |
