WormBase Tree Display for Variation: WBVar00093797

WBVar00093797 Name: Public_name: ok2693
    Other_name: R12H7.2.1:c.702_1261del
      CE03567:p.Phe235SerfsTer15
    HGVSg: CHROMOSOME_X:g.13219149_13219761del
  Sequence_details: SMap: S_parent: Sequence: R12H7
    Flanking_sequences: agacagaacggaatggtcgtggagctggat gagaaaagattcgatgggaccttcttctgt
    Mapping_target: R12H7
    Type_of_mutation: Deletion
    PCR_product: ok2693_external
      ok2693_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00032719
    Laboratory: RB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00000217
    Transcript: R12H7.2.1 (11)
    Interactor: WBInteraction000571520
  Isolation: Mutagen: EMS
  Description: Phenotype: WBPhenotype:0002606 Paper_evidence: WBPaper00041673
        Curator_confirmed: WBPerson2987
        Remark: "Likewise, loss of crt-1, cnx-1, itr-1, clp-1, tra-3, asp-3, or asp-4 partially suppressed HBx-induced cell killing (from 50% to 12-32% PLM death; Fig. 2A), indicating that HBx induces cell death in part through the necrotic pathway." Paper_evidence: WBPaper00041673
            Curator_confirmed: WBPerson2987
        Variation_effect: Hypomorph_reduction_of_function: Paper_evidence: WBPaper00041673
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: smIs98 [Pmec-3::GFP; Pmec-7::HBx] Paper_evidence: WBPaper00041673
              Curator_confirmed: WBPerson2987
  Reference: WBPaper00041673
  Remark: Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele