WormBase Tree Display for Variation: WBVar00093806
expand all nodes | collapse all nodes | view schema
WBVar00093806 | Name | Public_name | ok2702 | ||
---|---|---|---|---|---|
HGVSg | CHROMOSOME_III:g.8224374_8226557del | ||||
Sequence_details | SMap | S_parent | Sequence | C30A5 | |
Flanking_sequences | ataatttggaattttattctctttttagcg | tcttggagcagaaagactgtttttgagaac | |||
Mapping_target | C30A5 | ||||
Type_of_mutation | Deletion | ||||
PCR_product | ok2702_external | ||||
ok2702_internal | |||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00032728 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00004342 | |||
WBGene00016238 | |||||
Transcript | C30A5.3.1 | VEP_consequence | transcript_ablation | ||
VEP_impact | HIGH | ||||
Intron_number | 2-5/6 | ||||
Exon_number | 1-7/7 | ||||
C30A5.2.2 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | |||
VEP_impact | MODIFIER | ||||
cDNA_position | ?-80 | ||||
CDS_position | ?-56 | ||||
Protein_position | ?-19 | ||||
Exon_number | 1-2/6 | ||||
C30A5.2.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | |||
VEP_impact | MODIFIER | ||||
cDNA_position | ?-80 | ||||
CDS_position | ?-56 | ||||
Protein_position | ?-19 | ||||
Exon_number | 1-2/7 | ||||
Isolation | Mutagen | EMS | |||
Remark | Sequenced by Sanjib Guha and Maria Gallegos (Gallegos Lab, Cal State University, East Bay). | ||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |