WormBase Tree Display for Variation: WBVar00093809
expand all nodes | collapse all nodes | view schema
WBVar00093809 | Name | Public_name | ok2706 | ||
---|---|---|---|---|---|
Other_name | C54D1.3e.1:c.2033_3124+194del | ||||
C54D1.3d.1:c.1763_2854+194del | |||||
C54D1.3b.1:c.1748_2839+194del | |||||
C54D1.3c.1:c.1478_2569+194del | |||||
HGVSg | CHROMOSOME_X:g.7136188_7138060del | ||||
Sequence_details | SMap | S_parent | Sequence | C54D1 | |
Flanking_sequences | GAAAAAATGGTTATGATGGAAGAACACACA | TGTAGGAGTTCGAACATTAAAAAATTAAAA | |||
Mapping_target | C54D1 | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033295 | ||||
Laboratory | RB | ||||
Person | WBPerson154 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00002163 | |||
Transcript | C54D1.3e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||
VEP_impact | HIGH | ||||
HGVSc | C54D1.3e.1:c.2033_3124+194del | ||||
cDNA_position | 2033-? | ||||
CDS_position | 2033-? | ||||
Protein_position | 678-? | ||||
Intron_number | 13-17/18 | ||||
Exon_number | 13-17/19 | ||||
C54D1.3d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||
VEP_impact | HIGH | ||||
HGVSc | C54D1.3d.1:c.1763_2854+194del | ||||
cDNA_position | 1763-? | ||||
CDS_position | 1763-? | ||||
Protein_position | 588-? | ||||
Intron_number | 12-16/17 | ||||
Exon_number | 12-16/18 | ||||
C54D1.3c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||
VEP_impact | HIGH | ||||
HGVSc | C54D1.3c.1:c.1478_2569+194del | ||||
cDNA_position | 1533-? | ||||
CDS_position | 1478-? | ||||
Protein_position | 493-? | ||||
Intron_number | 11-15/16 | ||||
Exon_number | 11-15/17 | ||||
C54D1.3b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||
VEP_impact | HIGH | ||||
HGVSc | C54D1.3b.1:c.1748_2839+194del | ||||
cDNA_position | 1751-? | ||||
CDS_position | 1748-? | ||||
Protein_position | 583-? | ||||
Intron_number | 12-16/18 | ||||
Exon_number | 12-16/19 | ||||
Isolation | Mutagen | EMS | |||
Reverse_genetics | PCR | ||||
Genetics | Interpolated_map_position | X | -1.82848 | ||
Remark | I can send you the sequencing chromatogram if you think it can be of help. | ||||
alt_det = removes several exons and introns (1873 bp deletion) mut_det = | |||||
[210323 skd] Updated based on Allele Sequence confirmation form received by email. | Person_evidence | WBPerson154 | |||
Curator_confirmed | WBPerson51134 | ||||
Method | Deletion_allele |