WormBase Tree Display for Variation: WBVar00093812
expand all nodes | collapse all nodes | view schema
WBVar00093812 | Evidence | Paper_evidence | WBPaper00038379 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ok2710 | |||||||
Other_name | Y113G7B.17.2:c.22_499del | ||||||||
CE23297:p.Ser8CysfsTer63 | |||||||||
Y113G7B.17.1:c.22_499del | |||||||||
HGVSg | CHROMOSOME_V:g.20269152_20269683del | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y113G7B | |||||
Flanking_sequences | cgtagagacgagccttgtccgggaacaaca | cttcccgttttcggtactcattgtcccgct | |||||||
Mapping_target | Y113G7B | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok2710_external | ||||||||
ok2710_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00032731 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00013766 | |||||||
Transcript | Y113G7B.17.1 (11) | ||||||||
Y113G7B.17.2 (11) | |||||||||
Interactor (11) | |||||||||
Isolation | Mutagen | EMS | |||||||
Description | Phenotype | WBPhenotype:0000031 | Paper_evidence | WBPaper00038379 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants are apparently normal in embryonic and larval development, except for a slight slow growth (data not shown). | Paper_evidence | WBPaper00038379 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000134 | Paper_evidence | WBPaper00038379 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Loss of prmt-1 resulted in an approximately 50% reduction in the expression of sod-3 and mtl-1, and a 70% reduction in that of sip-1 and lys-7. | Paper_evidence | WBPaper00038379 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 22.5 | Paper_evidence | WBPaper00038379 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | Is[daf-16::gfp] | Paper_evidence | WBPaper00038379 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00038379 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Compared with controls, Is[daf-16::gfp];prmt-1 animals showed a significant decrease in the proportion of nuclear DAF-16::GFP when worms were starved for 6 hr and 12 hr. | Paper_evidence | WBPaper00038379 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 22.5 | Paper_evidence | WBPaper00038379 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | Is[daf-16::gfp] | Paper_evidence | WBPaper00038379 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00038379 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Loss of prmt-1 resulted in a statistically significant decrease in life span compared with wild-type worms. | Paper_evidence | WBPaper00038379 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Rescued_by_transgene | WBTransgene00015541 | ||||||||
WBTransgene00015548 | |||||||||
WBPhenotype:0001350 | Paper_evidence | WBPaper00038379 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Loss of prmt-1 in the Is[daf-16::gfp] background led to a marked increase in the intensity of phosphorylated DAF-16 compared with Is[daf-16::gfp] controls. | Paper_evidence | WBPaper00038379 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 22.5 | Paper_evidence | WBPaper00038379 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | Is[daf-16::gfp] | Paper_evidence | WBPaper00038379 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001370 | Paper_evidence | WBPaper00038379 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | DAF-16 in the prmt-1(ok2710) background bound to 14-3-3 protein to a greater extent than did the controls. | Paper_evidence | WBPaper00038379 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 22.5 | Paper_evidence | WBPaper00038379 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | Is[daf-16::gfp] | Paper_evidence | WBPaper00038379 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001382 | Paper_evidence | WBPaper00050741 | |||||||
Curator_confirmed | WBPerson14716 | ||||||||
Remark | Animals exhibit different levels of methylarginine protein modifications | Paper_evidence | WBPaper00050741 | ||||||
Curator_confirmed | WBPerson14716 | ||||||||
WBPhenotype:0001575 | Paper_evidence | WBPaper00050551 | |||||||
Curator_confirmed | WBPerson12101 | ||||||||
Remark | Loss of prmt-1 causes impaired ATP synthesis in mitochondria (Figure S2) | Paper_evidence | WBPaper00050551 | ||||||
Curator_confirmed | WBPerson12101 | ||||||||
EQ_annotations | GO_term | GO:1905447 | PATO:0000460 | Paper_evidence | WBPaper00050551 | ||||
Curator_confirmed | WBPerson12101 | ||||||||
GO:0005739 | PATO:0000460 | Paper_evidence | WBPaper00050551 | ||||||
Curator_confirmed | WBPerson12101 | ||||||||
Reference | WBPaper00038379 | ||||||||
WBPaper00050551 | |||||||||
WBPaper00050741 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |