WormBase Tree Display for Variation: WBVar00093896
expand all nodes | collapse all nodes | view schema
WBVar00093896 | Name | Public_name | ok2799 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | K12G11.3.1:c.241_831+3del | |||||||
HGVSg | CHROMOSOME_V:g.11888536_11889172del | |||||||
Sequence_details | SMap | S_parent | Sequence | K12G11 | ||||
Flanking_sequences | ggagctggaagtgttgttcaaataggaaag | ccttttaaataatatttggatttaaaatta | ||||||
Mapping_target | K12G11 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok2799_external | |||||||
ok2799_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00032797 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00010790 | ||||||
Transcript | K12G11.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | K12G11.3.1:c.241_831+3del | |||||||
cDNA_position | 289-? | |||||||
CDS_position | 241-? | |||||||
Protein_position | 81-? | |||||||
Intron_number | 2-3/4 | |||||||
Exon_number | 2-3/5 | |||||||
Isolation | Mutagen | EMS | ||||||
Description | Phenotype | WBPhenotype:0001171 | Paper_evidence | WBPaper00059839 | ||||
Curator_confirmed | WBPerson42723 | |||||||
Remark | shortened lifespan upon exposure to S. maltophilia JCMS | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00059839 | ||||
Curator_confirmed | WBPerson42723 | |||||||
WBPhenotype:0002398 | Paper_evidence | WBPaper00046860 | ||||||
Curator_confirmed | WBPerson14935 | |||||||
Remark | "sodh-1(ok2799) L1s fail to aggregate on ethanol-containing plates but aggregate normally in the presence of 17 mM potassium acetate. The other sodh-1 alleles, bet20 and tm2829, showed the same result." | Paper_evidence | WBPaper00046860 | |||||
Curator_confirmed | WBPerson14935 | |||||||
Affected_by | Molecule | WBMol:00004925 | Paper_evidence | WBPaper00046860 | ||||
Curator_confirmed | WBPerson14935 | |||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Remark | NO lifespan phenotype upon exposure to E. coli OP50 | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00059839 | ||||
Curator_confirmed | WBPerson42723 | |||||||
Reference | WBPaper00046860 | |||||||
WBPaper00059839 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |