WormBase Tree Display for Variation: WBVar00093915

WBVar00093915 Evidence: Paper_evidence: WBPaper00038487
  Name: Public_name: ok2818
    Other_name (21)
    HGVSg: CHROMOSOME_I:g.8206967_8207512delinsTTTTCAT
  Sequence_details: SMap: S_parent: Sequence: T02E1
    Flanking_sequences: cttccaatcgagttcatagctccatttatg aatttcatgcaagacactcaacttactaag
    Mapping_target: T02E1
    Type_of_mutation: Insertion: TTTTCAT
      Deletion
    PCR_product: OK2818_external
      OK2818_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00037105
    Laboratory: RB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00008570
    Transcript (11)
  Isolation: Mutagen: EMS
  Description: Phenotype_not_observed: WBPhenotype:0002469 Paper_evidence: WBPaper00038487
        Curator_confirmed: WBPerson712
        Remark: The probability and size of response to plate taps decreased with continued taps applied with a 10s interval, similar to the response of N2 animals. Paper_evidence: WBPaper00038487
            Curator_confirmed: WBPerson712
      WBPhenotype:0004027 Paper_evidence: WBPaper00038487
        Curator_confirmed: WBPerson712
        Remark: Animals exhibit an escape response (reversal) similar to N2 animals upon an initial plate tap. Paper_evidence: WBPaper00038487
            Curator_confirmed: WBPerson712
  Reference: WBPaper00038487
  Remark: Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele