WormBase Tree Display for Variation: WBVar00093931

WBVar00093931 Name: Public_name: ok2835
    Other_name: Y7A9A.1.1:c.835_1170del
      CE28151:p.Arg279_Leu390delextTer?
    HGVSg: CHROMOSOME_IV:g.16199417_16199929del
  Sequence_details: SMap: S_parent: Sequence: Y7A9A
    Flanking_sequences: CTTCGTTTAAATTGTACTTGTATACAGGATCCATCGCCGATGGAATCATC AGCAAGCGTCTCAAGGACAAATCGCAAGATGTTTCATACTATGTGACGTC
    Mapping_target: Y7A9A
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00032813
    Laboratory: RB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live: Curator_confirmed: WBPerson4025
  Affects: Gene: WBGene00012416
    Transcript: Y7A9A.1.1 (11)
  Isolation: Mutagen: EMS
  Remark: This was suppressed because it overlapped with a corrected genome sequence error feature Feature_evidence: WBsf898763
    This was un-suppressed after examination showed it is not changed by the corrected genome sequence error Curator_confirmed: WBPerson4025
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele