WormBase Tree Display for Variation: WBVar00093935

WBVar00093935 Name: Public_name: ok2840
    HGVSg: CHROMOSOME_II:g.6748790_6749583del
  Sequence_details: SMap: S_parent: Sequence: F41G3
    Flanking_sequences: CAAAGTGGCATATGCTGAGTTGTTGCAATAAGAACGCATAGCTGTACAAT GTGTCTAACTGTGAACGAGTGGGCTTTTAAACCATTTTCGAGCAAATATC
    Mapping_target: F41G3
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00037149
    Laboratory: RB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live: Curator_confirmed: WBPerson4025
  Affects: Gene: WBGene00018303
    Transcript: F41G3.10.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-593
        CDS_position: ?-586
        Protein_position: ?-196
        Intron_number: 2-4/5
        Exon_number: 1-5/6
  Isolation: Mutagen: EMS
  Remark: This was suppressed because it overlapped with a corrected genome sequence error feature Feature_evidence: WBsf047706
    This was un-suppressed after examination showed it is not changed by the corrected genome sequence error Curator_confirmed: WBPerson4025
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele