WormBase Tree Display for Variation: WBVar00093946
expand all nodes | collapse all nodes | view schema
WBVar00093946 | Evidence | Paper_evidence | WBPaper00040713 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ok2851 | |||||
HGVSg | CHROMOSOME_III:g.4167295_4168871delinsTCTCGATTCTATGGACTAAAATTAAACAGA | ||||||
Sequence_details | SMap | S_parent | Sequence | C16C10 | |||
Flanking_sequences | ctccctgattctctcgattctatggacttc | aagaataaataaagtcgtaatttttttttc | |||||
Mapping_target | C16C10 | ||||||
Type_of_mutation | Insertion | TCTCGATTCTATGGACTAAAATTAAACAGA | |||||
Deletion | |||||||
PCR_product | OK2851_external | ||||||
OK2851_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00037361 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00007627 | |||||
WBGene00007626 | |||||||
Transcript | C16C10.6.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
cDNA_position | ?-935 | ||||||
CDS_position | ?-935 | ||||||
Protein_position | ?-312 | ||||||
Intron_number | 1-2/3 | ||||||
Exon_number | 1-3/4 | ||||||
C16C10.5.1 | VEP_consequence | 3_prime_UTR_variant | |||||
VEP_impact | MODIFIER | ||||||
cDNA_position | 1240-? | ||||||
Exon_number | 10/10 | ||||||
Isolation | Mutagen | EMS | |||||
Description | Phenotype | WBPhenotype:0000055 | Paper_evidence | WBPaper00040713 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Balanced heterozygous hermaphrodites produce wildtype and arrested progeny. | Arrested larvae are the size of wild-type mid-L2 larvae. | ccdc-55(ok2851) homozygous animals remain arrested until they die at approximately 2 weeks of age. | Paper_evidence | WBPaper00040713 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00040713 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000644 | Paper_evidence | WBPaper00040713 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Animals exhibit late larval-onset paralysis. | Paper_evidence | WBPaper00040713 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001355 | Paper_evidence | WBPaper00040713 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | The gonad in the arrested ccdc-55(ok2851) larvae at 54 h is significantly longer than in the size-matched wildtype animals. | Paper_evidence | WBPaper00040713 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00040713 | |||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_not_observed | WBPhenotype:0000072 | Paper_evidence | WBPaper00040713 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | No overt defects are apparent in overall body morphology. | Paper_evidence | WBPaper00040713 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00040713 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000196 | Paper_evidence | WBPaper00040713 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | ccdc-55(ok2851) DTCs are normal in general morphology. | Paper_evidence | WBPaper00040713 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00040713 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000709 | Paper_evidence | WBPaper00040713 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | No overt defects are apparent in pharyngeal morphology. | Paper_evidence | WBPaper00040713 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00040713 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000710 | Paper_evidence | WBPaper00040713 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | No overt defects are apparent in intestinal morphology. | Paper_evidence | WBPaper00040713 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00040713 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000778 | Paper_evidence | WBPaper00040713 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | No overt defects are apparent in ingestion of mCherry-labeled bacteria. | Paper_evidence | WBPaper00040713 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00040713 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001006 | Paper_evidence | WBPaper00040713 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | No overt defects are apparent in rate of pharyngeal pumping. | Paper_evidence | WBPaper00040713 | ||||
Curator_confirmed | WBPerson712 | ||||||
Recessive | Paper_evidence | WBPaper00040713 | |||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00040713 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |