WormBase Tree Display for Variation: WBVar00093957
expand all nodes | collapse all nodes | view schema
WBVar00093957 | Name | Public_name | ok2862 | ||||
---|---|---|---|---|---|---|---|
Other_name | CE32428:p.Val478GlufsTer17 | ||||||
F53B6.2c.1:c.1432_1949del | |||||||
F53B6.2b.1:c.436_953del | |||||||
F53B6.2a.1:c.1438_1955del | |||||||
CE32429:p.Val146GlufsTer17 | |||||||
CE36859:p.Val480GlufsTer17 | |||||||
HGVSg | CHROMOSOME_I:g.8933377_8934007del | ||||||
Sequence_details | SMap | S_parent | Sequence | F53B6 | |||
Flanking_sequences | gccactccaccaattcccaatgtcaatttc | ctgaatgcatttgagagcagctttttgttt | |||||
Mapping_target | F53B6 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | ok2862_external | ||||||
ok2862_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00032830 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects (2) | |||||||
Isolation | Mutagen | EMS | |||||
Description | Phenotype | WBPhenotype:0001930 | Paper_evidence | WBPaper00040335 | |||
Curator_confirmed | WBPerson7190 | ||||||
Remark | Animals extend fewer muscle arms to the dorsal nerve cord compared to the ventral nerve cord | Paper_evidence | WBPaper00040335 | ||||
Curator_confirmed | WBPerson7190 | ||||||
Reference | WBPaper00040335 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |