WormBase Tree Display for Variation: WBVar00094041
expand all nodes | collapse all nodes | view schema
WBVar00094041 | Name | Public_name | ok2954 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE36100:p.Ala196GlufsTer19 | |||||||
C12C8.2a.1:c.587_833del | ||||||||
HGVSg | CHROMOSOME_I:g.9329188_9329881del | |||||||
Sequence_details | SMap | S_parent | Sequence | C12C8 | ||||
Flanking_sequences | ctgttgacgttgaaaaagaaaaggattttg | agttgttacagtatcatcttatgataattg | ||||||
Mapping_target | C12C8 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | OK2954_external | |||||||
OK2954_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00037169 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00007533 | ||||||
Transcript | C12C8.2a.1 (11) | |||||||
C12C8.2b.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 3/3 | |||||||
Exon_number | 4/4 | |||||||
Isolation | Mutagen | EMS | ||||||
Description | Phenotype | WBPhenotype:0001236 | Paper_evidence | WBPaper00042204 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "We obtained deletion mutants for two genes involved in BCAA breakdown (mce-1 and pcca-1) and one from the methionine metabolism pathway (cbl-1) (Figure 3). These deletions were introduced into the Pacdh-1::GFP dietary sensor strain. Deletions in mce-1 and pcca-1 both caused increased GFP expression on all three diets, and a deletion in cbl-1 caused increased GFP on Comamonas DA1877, but not on E_coli OP50 (Figure S5)." | Paper_evidence | WBPaper00042204 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | Pacdh-1::GFP | Paper_evidence | WBPaper00042204 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00042204 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |